Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-fgenesh-gene-0.1
Orientation:
(+)
Number of Exons:
4
Description :
Chromodomain protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Chromo domain/shadow14.838PS50013
HmmSmart predictionP-Valprediction_id
Chromo domain/shadow3.1SM00298
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Chromo domain/shadowIPR000953
*** None ***
InsideOutsideTMhelix
1-310
368-373
424-435
485-489
334-347
397-400
456-464
311-333
348-367
374-396
401-423
436-455
465-484
*** None ***
PositionContextScore
114SVSRPRR|KA0.656
TypeScore
nuclear348
GO
*** None ***
*** None ***
*** None ***
Sequence
        1893 bases(100 bases per row)
ATGGCGGCGGAGATCGAGCGCATCGTGGACAAGAAGACCATCCGCGGTCGCGTGCACTACCTGGTGGTATGGCGCGGCTTCGGCGAAGAGAGCAACACCT
GGTGCGATACGTTTTTTCTCTCTCTTTCTATTGATCTATCTATCTATGTGTCGCGACGTCTGGCTTTAGCCAGCCAAGTATGTGTATATATCTATCTGTC
CACCAGTCGCTCATGTCATGTAATTGTACTTCTTCTTCTTCTGTTGTTGTTGATGTTGCGACACCAAAACAGGGAGAGCCGAATGGACCTCATGGCTGAC
GGCTTCTCATCCGTGATCCGCGAATACGAAGACAGTACGTGCAGCATGCGCTTACATCTCTCTCTATCGGTGTCTGCCTCTGCTGTTCGAGAGAACGCTG
GACGTTGAGAGATGGAGTGAAATGGAATAGTATGAAATCGAATATCTGATCTGTGTGCTTCCTCCTTGTTCCTTTTTTCTTTCCAGGCCACAAAAAGAAG
CGCGATGGCTCGGCCACGCCGACCTCGTCTCGCAGCCGCAGTCCGAGCCGCGGCCGCAGCCCCGGACGCCCGAAAGGCAGCAAGAACCGTCCCAAGAGCG
CCACGGAGAGCAAGTCACCGTCTCGCGGTCGCAGCCGCAGCAACTCGGTGTCGCGCCCGCGCCGCAAGGCCGCTACCAGCGACAACAACAGCGAGAACGA
CAAGGCGGCGAGCAACGCCAGCGCCAACGCCAAGCCGACGACGACGGTGGTGGAAAAGGTCGCGGAGACCTCGTTTGAGCCGGAGAAGCAGCTTACCGTG
CAACACAGTGACGAAGACACGGACGTGCTCTTGCGCTCGACACTCAAGGCACTCGAGACGCACGTGATCAAGACCGCAGCGTCATCATCCAGCAGCAGCA
AATCTGCTGTGGAGGTAGACGCAGCAACGACGCCGCGCAAGTCGCCGCGCACGAAGGCGTCGCCTAAGTCGGTCAAGACCGAGATGCAGACCATCTCGCT
GGCGTACGAAGAAAACGGACGCGTCTTGAAGCAGACGACCCAGCAGACGATCGAGACGGTTGAGACCCACTCGCACGCAGCAGCGCACTCCCATGCCCAC
GTGTCCGAGTCGTCCAGCACCACCACTACCACTGTCGTTACCACCGAAGAGCAAGAAGAAGCGGAGACCTCTGCGCTGCTGCATCGCGTGCCATCGCCTC
GTGCCAGCAACCGAGGCGGCTTCGTCGACATGATCACCAAGATGACGGAGCGCGGGTGGCTCGTGTCGTTTCTGAGCGTCGCGGTCGTGATCGGATCGCT
GCTCGCGAGCCAGATCCTGCCACGTAATGATCCAGAGAACAACAACAACGAGGGTGAGAGCGACCTGTGGCGCGCGTGGCTGCCCTTCCTCACATCGATC
GTCGCGCTGCTGCTCTTCTTCCACCAGAAGGACGACCGCGCATCCGCCAAGTGGATCGCGATCGCGCTCTCGTGGCGCTGCGCGGCGGAACTACTCGTGC
TGATCGGCACGACCCCGCAGGAGTTCCAGACCGTGGCCGCCTCGGCTGCTGCAATCGCCAACCTGGCGCTGCTCATCGCGTTCGGCTCGCTGGTTCGCAA
CAAGGAGCACGAGAACTCCAAGGCGACGCTTGTGGCGCTCGCTGTCGCTGCGCTTGCGCTGTTCCTCGCCGACAGGTACGCGATGGAGCTCTTCAACTTG
TCTCTCTTTGTGAACGAGCCATTCTAACGAACTTTGCTGTGTTCTCTCTTTCTCTTTGTGCTTCCATCATTCTAGCTGGACGGTGACAACGAAGAACCCT
GCGCTCGAGTCCCGGGTGATCCTCATGTCAATGGCAGTGCTGGGCATCTCGCTGTCTCCAGCGCTCACTGCGACCGCAGACGACGACGAGTAG