Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-0.47
Orientation:
(-)
Number of Exons:
8
Description :
Cingulin-like 1
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Pleckstrin homology domain9.783PS50003
HmmSmart predictionP-Valprediction_id
Pleckstrin homology domain3.9SM00233
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pleckstrin homology domainIPR001849
*** None ***
InsideOutsideTMhelix
1-1057
*** None ***
PositionContextScore
347KLSRVAR|PV0.666
383KENRVAR|SV0.83
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3782 bases(100 bases per row)
ATGAGCGAGACCACGACGACCGCAGACAGCGAGCAGCAGATCCCCTCACTCGCCGTCGCCGCGCCAGATGGAGACGATCACCATGTGGTCGCGGATGCGG
ATACCGCGAGTAGTCCACCCGCGCCACCGTCGCTAGATATGGCGATTGTGGCGGAGACAAGCAGCGATGGGGCTACTCTTACTGCAGAAGAAGAAACGAT
TGTGATAGAAACAGAGGAGACGACGATGATTGAGCCGATTGTAGTCATGGTCTCCAGTGAGAGGGAAGTCACCGTTGATGGCGAGGACGCGGATATGGTG
GTGATCACGGAGGCGGCGACACCCTCGTCCACATCGTTCGAGGCGCTCGAGTCTCCGTCGGCGATGCCAGAGAAGCTGCCTGTGCACGCAGCTGACGTTC
AAGTCAGCATCGTCGCAGAAGCCTCAGCTGAGGAAGTTAACAGTGACGACATCATTGAGCAAGTGAATGGGGAAGCGGCGGCGGCGGCTGCTGCTGCTAT
TGCTGAGAAGAAAAACGAAGAGACGAAAGCCGAGGGAGAAGGAGGAGAAGAAGAAGCGAAGACGAAAGACGAGCAAGAGGTGAAAGAAGCGACGGCAGCA
GGAGGTGCCGAAAAAAAGCCAAAGCACACGAATGTGGACGAAGCCACGGCGAAAGTGCTGGAATCGTAAGCCAAGCTGCTATGTTCTCGTGCAACTCTGA
CGGGTTGTGGATTGCGGATCTAACGTTCACGGGTGTGTTACACTTTGCAAATGTAGGATCGAGTACGAGTCTGCAACAATCAGAGACGACGGTGAAGTGC
TGGTGCTGCCGAAGGGATGGTCGACGCGTGAGAGTAAGACCCACGGGGGCAAGACGTATTATGTGTCGCCGTATGGACACACACAATGGTTGNNNNNNNN
NNNNNNNNNNNNNNNNNNGCCGCTCCGCACTGGGGTCATGTACAAATGGGTGCACGAGATCGAGGTGGCGTTCGATTATGGCCGACTCGGTCTCAATTTG
AAGCAGATCGCGGGCGAACCAGGTGCTGAGTTCTCGGATCTCCAAGTGCACATTGCGGAGGTTTACAAGGTACGATTTGGTATGCTTGGCTTGAATGATG
CATCATGCTGAATGTACGCTTACCTACTCATTTGTGTGTGCTTTGTTGCCAGTTGCCGAATGGCGAGCCAAGCCCTGCCGAGATCTACAACTGGGGCGTC
AAGCCAGAGAAGTACGTAGTTGTGTAAAATATTCCTGTCCAGTTATATTCGCCTAGTTGCTAAGCATGAGTATCTTTCTGTGTGCAGACGCCTGATTGTT
GGAATGCGAATGACCGCGATGAACGGAGAACCGCTGACGGGGTTTACGTACAGCGAAGTGCTCGAAAAGCTGAGCAGAGTTGCTCGTCCAGTTCGTATCA
AGTTTGCCGACATCTCGAAGGGAATTGTGGTGCGTTTGATTTGTGCTAACAGCAAACTTGCTTGTGTGACATTTGCGTGCAAATCGCTAAACTGTCTGAA
ATGTGGATGTCCAATAGGGTCGAGTTCAAGAAGAAGTTCCTCAAGAAGAAACCGAGGAAGAAAAAGAAAATCGAGTCGCGCGCTCGGTGCAAACCTCATT
GCGTCTCGAGTACTTCCAGATGCTTGTCGCGTATGAGCTGCATCAACAAGTGTGGAGGATTTCGCGACAACGAATGGAGAAGAAGGAGATCGAGCTGGCG
AAGAAATTCGAAGTCGTGTCGTCCCAGGTGGACACGATGAACGAGTATGCGGTTTTACTTGAGAAAGAGCGTGAAAATTTGATTCAAGAAACGAGCACTC
TGGAAGAGAACATTGAGCAGCTGAAACTTCAAGAGGAAGGGAAAATCGAATCCCCAGAGGTTACCAAGACCACGGAGTTGACCGCACGTAACATGGAGCT
TGATAAGGAAATCGCCGAGCTCATCGTGGAGAACGAAGAGCTGCGTCAAGCGAGAGTCGTTCTTGAAGAATCACTGGACGCGGTGCAGCTGGAACTGGAT
CAGTTTGTGGACATTGACAACGATGACGGTGTGTACGAGATCGACGTGTTTTCATCTGCTTTTCTGGGTTCGTACATCCAGAGAGGTTCGATTGACAAGA
AAGCTGACAACGCGAGGGAGTTGCTGCTCGCGAAGATCAAGCACAAATGCGGCCAACTCGAGGACGACCTAGAGAAAGAGCAAGAACGAGCGCAATATGT
GGAGTCGGAGATTTCCCAGTTCAAGAAGCAGATGCAGTCAGTCGCGATCGCGTCCAAGCGCGAGGACGACTTTATTAGTGGCGAGAAGCCTCCACAGTTC
ATCTTCCTGGAGAACCGAATTGACTATCTGAGGAAGACTCTGGTGAGTGCTGCCCATGTTGCCCCGCTTTTGGCGGTTGATTAGTTATTCTAACTCGCTT
TATGTCGGTGTATCTGTTTGCAGCGCGAAACAGTTGTGGCTATTGCAAAAGCCTCAAATGACGGCGATCACGCCACTGCAGACAACCTCTCGATTCGCCG
TGCTGCTCTGAAGGACGATTTGAAGAACTCGCTTGATGAGTTTCAGCGAATGGAGAAAGAGCTCAACTCTCAATCTGAAAGCGAACGACGATCGTCGCTT
GTGCGTCCAAGTATTACGGAGCCTGAGGACCCACACGCTAGCATGAACATTGACCAGATTATGGAAGAGCGCGCCGCAAATGCAGCTCGTCTGCAGAAGA
AATTAACCAAGTTGCGGGTTGAATTGGTACGTTCATAGGTTGTAGTATCCTCCTGTGTGAGCCTTCTTGCATTGCAGTAGTACCTAACCTAACTGATTTT
GATTCTTTTCCGCTGACAGCAAGAAGTGGTGGCCGAGATCACATTGGCTTCGAATGCGAACGACGGTCCACGTCTCACTGAACTGAACGGCCGACGCACG
GAATTGAAGAACGAAATGGCTGCGCTTCAAGATCAAATCCAAGGAAGATCCTCGGTGACTGCCATGTCCGCTGAACGGGGCAGTATGTCAGGACGCACCT
CGCTGATTGCACCCACATCGCGTGCGTCGCTGATTAGCGCTACAACGCGTGCATCGTTGACTGGGGCTACAGCACGCAGTTCGCTGAGTGGGGCTCCAAT
GCGTGGATCGTTGACTGGGGCTCCAGCACGCGCCTCGCTGAGTGGAGCTCCTCCTCAACAAGAGCGAATGTCATCCACGAGACGGCTTTCAGGGATGCCT
GAACGTCGAACTAGCCGCAGCAGCAGCGACGCGTCCATGGCGTCGATGGCTCCGTCGACGGATTCGAACGCCAACTACGTTCCAGGCGTTGACGGCAGTA
TGCCAACGCTGAGCGGCAAGCTGATGAAACACCCGAGCCACTCGAACGAGAAGGGAGTGTTTGGGAACATGTCGCTACGCGGCTTTCGTGACCGCTGGTG
CGTGATCGACCCTGAGGGGTACCTCCGATACTACAAACGCAAGGGTGACAAGGAGCCGCGAGGCTCCATCCCGCTCGCGATCGCTGGGCTTGAGATCGTT
CAGGCGAAGTCCGACGGTAAGCCGAACGAGTTTCTGGTCTGTTCACCGACTCACCAAACCCGATTCCTCGCCAAGAGCCGCGATGAGATGCTCAAGTGGA
TGAAAGCACTGGAGCTCGCGCACAAGATTTTGATCCAAAACGGCATTTCGAACGGCCCTCCTTCTCTGCGTCACCAGGAAAGCACGGCTTCGAACGACAA
TGGCGTTGCGTCCTCCTCCGCTGGCCCAACTCCAGCGAACGAAGAATCCTATCGAGCATCCCGCGCGACTCTGGGCTTTTAA