Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-1.42
Orientation:
(-)
Number of Exons:
1
Description :
Gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-120
NN-scoreoddsWeighted Score
0.8561.9950.004
*** None ***
TypeScore
mitochondrial391
GO
*** None ***
*** None ***
*** None ***
Sequence
        363 bases(100 bases per row)
ATGCGGTTGTTGTACTGCTTGTTGCACTCAGCGTTGGTGATGATGCGCACGTTCACTTCCTGCATAGTCGAGGCGGCGACGCCGGTCTCGGTCATGCCCC
AGCCGCGCACGACCGCCATGGTCTTCTCTTTGTTGTCCGAGCCGTCGGCAGCCGCGAGCGGCACGGGCTTCATGGTCGACGGTGCCGAGAGCTTGAGAAC
CGCGACGTCGTACAGGTGGTCGGTCTTGTTGTACTGCGGGTGCACGAAGCTCTCGGCGACGGCGATGCGCTCGCCCTCGAGCGTGCCCTTGGCGTACTTG
GAGCCGATGGACGCGTACATGGTGATCGTGTCCTTGACGCAGTGCGCCGCCGTGACCACGTAG