Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-0.48
Orientation:
(-)
Number of Exons:
7
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-368
*** None ***
PositionContextScore
77AVTRPKR|AT0.552
90SAARSKR|LI0.685
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1620 bases(100 bases per row)
ATGGCCGACGCGATCAACCTGCTTGACGACCCGCACGCGCTCGTGTCCGCGAGCGACTCGGAGGCTGACTCGGCGTCGCTCTGCGGCAGCGAGCTGGAGG
CCGAGATGGCGTGGGGCGAGGGACCCATCGCCCCTCTGCGAGCAGCTACATCCACGACGACGACCACCGCCACCACCGCGTCGTCCGCCGCTGTGAACGT
GAGCATCGCGGCTGTGACGCGTCCAGTGGACACCCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGCCGCGCCAAGACTCCACAGAAA
CGCGCGACCACGCCCGAGACCTCAGCTGCGCGCAGCAAACGCTTGATTAATATCAACCCAATTCGGTCGGCGGCGTACCTCATGAAGCCGAACGAGCTCC
CAGTGGGCGTGCGAAAGCAGCAGCGCTGGTTCAATGGTACGGATTACGCTGTGTTTGTGCCTATGAAAGAGAGAGAGAGATGTTGTTTGCTCATATGTGT
GAATATTGGTGCCGTGACGAATGATGTGTGTGAGCAGACCATCACTTTGGCAACCGCGCAGCGTCAACTCGCATTGAGGATCTGATGGAGCACATGTCGA
TCAACGTCGAGTGGAAGTATGAAGAAACATGGCTGCATCCATCATTCATGTATGGCATTGGAAAATGATACTCACGTGCTTTCCTTCTTTGCACCGTTGC
AGATCCAACTTCCAAAAGCTCGCTGAACCGCAAAACCAGGATCTCCAGACTGCGTTCCGCAAAGGAAAGATGAACAAGAGCGAGCAGGCAAAAGAGCCGC
GACTGCGCCGCCGTGACGATTGGAATGGTAAGCGGCAATTCCCTAAGTTCTTTGCTTTTTTTATATGCCACAGGGCTCCTATTGACAGCGTGTAACATTT
TGCGATTCCAGATGCCGAAGAAATGTTCCTTCGCATTGACCGCCGCGCGCGAACGCTCCTCGTCCGCTCGTTCCAATCGTTCTCGCAGTTCATTGAAGCT
GTGGAGTACGTGGTGCTTCACTTTATCCAGGTACGCACATGTCAGCGCCATGCATCCTTGCAGTTTTGATTTTGTGAAACTGACTGAGTGGTTTTTTTTA
ATGTGTTTCCAGTGGCGTGAAGTGCCGTCGGAGATTGAAGTTGCCGCGGGGTTGCTCCGTGTGCTGACGCACCCGATGGAGCTGCTCAAGGCCAGTGAGA
AGGACATCCGCCTTGTGATTCCTCTCGTGGACTCAGCGTTTCACCGTCTGATCATCCACAGCGTTTGCCAGTTTTACGGCGTTCGCTCTCGCAGTACGTT
TCTGTTTTACTTGTATGCCAAGGTTTACCTTTGGTGACACAATGTTCACATTACATGTTCCTTCTTTTCTCTCATGCGCAGCCGAGGCGAACCGTCGTTT
CAACACGAAGATCATGGTGCTGAAGAGCTCGAAGACCAAGTTCACGCCGGAGGAGCTCGCGAAGAACTCGCTCTGTGAGTTCATCCGCGAGACCCGCTTC
GTGGCGCAGGCAACGTTCGAGCTGCAGCACGTGAGCCCCGAGGACGTGCAGCTCGAGGTGCAGTCCAAGTCGAGTGAGTGCAGCGATGGCTTTACCATGA
TGGAGTTTCCTCAGGTTTAA