Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-fgenesh-gene-1.18
Orientation:
(-)
Number of Exons:
4
Description :
NEFA-interacting nuclear protein NIP30
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-220
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        970 bases(100 bases per row)
ATGGACGCGAGCGGAGCTCCTCGCACGGCGCTGCCTGGCTTCGTGTCGACGACAGTGCTCACGTCCTCGGATGGCGTACGTAGCATCGCGATGTGCATCT
GCTTCTCTTGTAGCTGCGTGTGGCTTGGCAGTGCTGAATGGCTAACGAATACTGTGGCTGTGTGTATGCGGAATCTCTAGCTCTTTGGCGACAACGTGGA
GGAGCAGCGCATCTCGGAGGCGCCAGCTCCGAACGCGCAGGACGCCGCCGACTACAAGCCGCTATACGAGCGGCTGCAGGAGCTCAAGGACAAAAAGGAC
AGCGAGTGGAAGCAGAAGAACAATCCCTTTGGTAAGGCACCATTATCGTGTCACTGGAAGATCATTCACTTGATTGGAGGAGCTGACGTGCTGGTTGTCC
TTTTGACTTGAATGCTCAAAATTTCACCATCTAGCGCCGCCGAAGGCTCTGGACGACGAGGAGATTCAGTTCATCCGCGATCTGGAGGAGCGCCAGGCAG
AGTCTCAGCAGCGCCGCAAGGAGCAGCACAACGAAGACCTGGCCGAGTTTTGTACGTATTTTGGAATAGCGAGAAGCTCTCTGAGTGTGTCTTTGCAACG
AAGACTGACTGTCTGCGTGTGTATCACTTCCTATTCCCAATGGCTTATAGTGCTCGCCAAGCAGAAGAACAGTGGATCTGCTCATACAACAAATGGCACT
GGTGGTGTTTCAGCTGCTGGTCCGCTAGCCGGCGTTGTGCTGACAGAGGAAGCACTGCAGAAATATGTAAAGCCCAAGAAGAAAGAGGCGCCAGTGGTCG
TGCGCGCGAAGCGCAAGGCTGCACTGAAGGACAAGTCCGTCGCTGGAGCCAAGAAGCAAAAAGCTGCTACTGTAGCCGCCACTGAAGAGAAAGAGAAGGC
GAAGAGTGTAGGAGCAACATCCAGCATCGGACTCGTGGCGTACGGGAGCGACAGCGACGATAGCGATTGA