Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-0.45
Orientation:
(+)
Number of Exons:
1
Description :
Dual specificity protein phosphatase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein-tyrosine/Dual specificity phosphatase15.76PS50056
Dual specificity phosphatase, subgroup, catalytic domain15.998PS50054
HmmSmart predictionP-Valprediction_id
Dual specificity phosphatase, subgroup, catalytic domain2SM00195
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-440
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein tyrosine/serine/threonine phosphatase activityGO:0008138IEA
phosphatase activityGO:0016791IEA
protein dephosphorylationGO:0006470IEA
KO ID
K06639
K06639
K06639
*** None ***
Sequence
        1323 bases(100 bases per row)
ATGCGCCGACTGTCCAGCAACCCAAAGTCAGCGCCTGTGATTGAGTTTGTGCCGGGTCTCGTGTACTACACCGCTGTCGCTGCGGACCCGGCGCCATGCG
ATGGCATCATCTACTTCTCTATCGATGACAAGCTTCACTACAACAACTTTTACCTGGACTTTGGGCCGCTGAACCTCGGATGCACGTTCCAGTTCTGCAC
GGTGCTCAGTAAGATGGTGACCTCGGCACTGCAGACCCAGCGCAAGATCTTCTTCTACTCGTCTCCCAACCCCACGTTCCGCGCAAACGCCGTCTGCTTG
CTCTGCTGCTGGGGCGTGCTCTCCAAGGGCATGCATCCTGAAGATGTGGTCGCCAAGTTCTCGTCGATGACGTTCCCGGCGTTCCACGATGCGAGCCCAG
CCGAGTGTGACTACAAGCTTACGATCTTAGACTGCATCAAAGGGTTGCTGAAAGGAGTGCAGCTTGGATACGTGGACCCGATCGGGTTTGACGTGCGTGA
ATACCACCACTACGAGCAGGTTGAGAACGGAGACTTGAGCTGGGTGTCCCCAAAGTTCGTGGCGTTCGCTGGCCCTCATGACACTTTCTCTGCGAGCGCC
GATGGGTATGTGACGCTCACCCCAGAGCATTATATCCCGTACTTCAAGAAGAAGAACGTCACGCTCGTGGTGCGACTGAACGAGAAGCAGTACGACGAGA
AGCGCTTCACGAAGGCCGGTATCAACCACTTGGATCTACTGTACCCTGACGGAGCGAACCCACCCGAGTTTATTCTCAAGCAGTTCATCTTGGCATGTGA
GCAGACCCCCGGCGCTGTGGCAGTGCACTGCAAAGCTGGACTTGGACGCACGGGCACGTGCATTGGCGCGTATCTGATGAAGCACGACAAATTTACGTCA
AAGGAAGCGATCGGATGGCTGCGCATCTGCCGTCCAGGAAGTATCATTGGTCCGCAGCAGCAGTACATGGACTCGATCCAGCACAAGATGTGGCGAGCCG
CGAAAGACGAAGAAGATCAGGAGTACAAAGTTGCGTCGTCAGTGGCAAGCAGTGACAAGCGACTTGCGAAGCAGACGTCGACAAGTTTGTTCAGCATCAA
CATCTTCTCGCGGTCAAGCAAATCTGACTTCAGCTCCATGAAAGACTCATCCCTTGGTAGCAATCAGAGTAGTGGAGCTGGTGATCTGAGCAACAGCAAA
CCGCTGCCTCACTATGGGAATGCGTCAGCGTCATCGCCGCCTCTGAAGTACTCGGACGAAAAGACCCAGGGCGACAACCTGCTCCATCTGAAGCAAAGCT
ACCAGTATCGCTATGTAAGGTAG