Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-0.57
Orientation:
(-)
Number of Exons:
3
Description :
U3 snoRNP-associated protein Utp7
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WD40-repeat-containing domain12.156PS50294
WD40 repeat11.745PS50082
HmmSmart predictionP-Valprediction_id
WD40 repeat460SM00320
WD40 repeat35SM00320
WD40 repeat460SM00320
WD40 repeat7.6SM00320
BING4, C-terminal domain9.5SM01033
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
BING4, C-terminal domainIPR012952
*** None ***
InsideOutsideTMhelix
1-563
*** None ***
PositionContextScore
510RPSRRFR|KK0.531
TypeScore
nuclear826
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1934 bases(100 bases per row)
ATGGCGGCCTCTGACTACGACTCCAGCGACAATGGCGGCAGCGACTCCGAGCCGGAGAACGTCGAGCAGATCGTGCGCGGCGCCGAAACGCGTCTCGGAC
AGAAGAAAGCCAAGAAGGCGGCCGAGCAGAAGAAGAAGCCCACCGCCAACGTGAAGAACCTGGAAAAGTACAACCGCCACGCGACGCTCTCGCAGAAGAA
GATCAAGGTGCGTCTAGCCTTTCTCTATATGCGTTGGTGTGGGTGTTGGTGTTGGTGCTATAGTGTGCATGCGCTTGATTGATGCTGTTTATTGCAATGG
CTAATATTGTCTGCGGCTACGTATCATTACTTTGACGTTTGCTGCTGCTATTTGGAGTAGAACATCAAGGACAAGAAGCTCAAGGGTAGCTTGACGCGCA
CGAACGCCAAGCACCAGCAGGCCGCGATCTCCGCCGCCAAGTCCGAGATCCTACTGCCGAGCGAGGCCGGACTCCTGGAGGCCGAGGGGCTAGAGAAGAC
GTACAAATTCACACAAGCGCAGCTCGCGGAGAATGTCGACCAGAACACGGCACGCAAGATCTTCAGCCTCGACCTGCCGGACTACGGCTCGTACCGCGTC
AAATACACGCGCAATGGTCGCAACATGCTGCTCGGCAGCGAGAAGGGCCACCTGGCGGTGCTGGACGCGCTGCGCATGAAGCTCACGTGCGAGTTCCAGG
CCAACGACCTGGTGCGCGACGTTGTGTTCCTGCACAACAACTCGATGTTCGCGGCTGCGCAGAAGAAATACGTGTACGTTGTGCGCTTGTGTGTGTGAAT
GTGCGGCTATGATACTGGCAAATGGACTAATGAATGCATGCTATGCTCGTCCTATTCAACAGATACATTTATGATAGCACGGGCGCCGAGGCGCACTGCA
TCCGAACAGTGCCCGAGCCGCGTCGCATGGAGTTCCTGTCGTACCATTTCCTGCTCTCGACGGTCAGCGGCAACGGACTGCTAAGTTACCACGACGTCAC
GAACGGCAAGCAGGTGGTGGCGCACAAGACCAAGCAAGGCTTCTGCGATACGATGGCGCAGAACCCGTGGAACGCCGTGATTAACCTGGGCCACGCGAAC
GGCATCGTGTCGCTCTGGACGCCCAACATGTCCGAGGCGGTCGTGAAGATGCAATGCCACCAGGGTCCGATCCGTTCGATGGCGATTGACAACAGCGGCA
AGTACCTCGTGACGGCCGGCGCGGATCGCAAGGTCAAGGTCTTCGACCTGCGCAAGTACCAGGAGCTGAACGAGTACTACCTGAGCGCAGCGGCAAGCAC
GATGAGCGTGAGTCAGCGCGGACTCGTGGCGCTGGGCTTTGGGCCGAACGTGCACGTGCTCAAGAATCCGTTTACGGCGGCGTCTCCGTCGCCGTACATG
ACGTACTCCATTCCAGGCTCGCAGGTGACGTCGCTAGCATTCCGACCGTTCGAAGACGTGCTCTCAGTGAGCCACGCGACCGGCCTAAACAACATTGTGA
TCCCAGGCTCCGGCGAGCCGAACTTCGATACGTACGAGGCGAACCCGTACGAGAACGCCAAGCAGCGCGGCGAGTCCGAGGTGCGTGCGCTGTTGGAGAA
GCTGCGTCCTGAGATGATCACGCTGGACCCGACGGCCATCGGCCGCGTGGACCTGGACCCGGCCGAAGAGCAGCAGAAGAAGATTCACCAGATGGCACGC
GCGAACAGCGAGGGCAGCGCGCCCCCCAAGAAGAAAATGCGCGGCCGCAACCGCCCGTCGCGTCGCTTCCGCAAGAAGCAGCAGAATGTCGTGGACATCC
AGAAGGAGAAGTTCCGGGAGACGGTGGAGAATCAGAAGAAGCGGAAAGAGCGCCTGCAGCAGCAGAAGGAGTGGAACGACAAGGCCGAGAGCGCGCCCAC
GGCGCTCAACCGGTTCTTCAAGAAGCAGCCGTAG