Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-fgenesh-gene-0.21
Orientation:
(-)
Number of Exons:
1
Description :
Transmembrane protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-51
101-112
75-77
136-409
52-74
78-100
113-135
NN-scoreoddsWeighted Score
0.8635.0250.01
PositionContextScore
217ALSRAAR|LA0.577
TypeScore
endoplasmic reticulum778
GO
*** None ***
*** None ***
*** None ***
Sequence
        1230 bases(100 bases per row)
ATGGCGGCCAAGACCAAAGCCTCCACGTCCCCACAGAAGAAGCCGCAACAACAGCAGCAGCAAAAGCCCAACGGAAAGCAGGACGAGAAGCTCGCCACGC
TCGCCGAGCAGCTGCGCCAGGAGCGCAAGAAGCTGACGCTACTGCGCCGTCCGCTGAGCGTGACCTACCACTTCAGCATCGTGTTCGCACGCTTTGTCAA
GTGGCTCTTCCTCTACGTGATCAAGCACAACGCGACGCGCTTCCTGCTGCTGCCGCTGCTCGCGCTCTGGATCACGGCGTCCGTGCTCGAAGGTGAGCAC
CACAAGATCCTGGACGAATTTAACAAGAATGTCGAGTTTGTTGTATGGTGGGTCGGGCTCGGCGTGCTCTCGTCGGTCGGACTCGGCACGGGGATGCACT
CAGGCATCCTGTTCTTGTTCCCGCACATTTTCCTCGTCGTGCAGGGGGCTGAAGAGTGTGGGTCCGTGAACTTTGACTCGCGCAACCACATGTGGTTCCG
GGAGTTTGACGCAACGTGCCAGGGCGAGCCACTGGCCGGTGGCGCGACGTTTATCGCGATCTTCTGGAAGGTGTTCTGGCCCGCGATGCTCTGGGGAGCG
GGCACGGCCGCGGGCGAGATTCCTCCGTACGCGCTCAGCCGCGCGGCGCGATTGGCCGGCCAGCGCAACGAGGAGTTTGAAGAGATCGCCGAGTCCAAGT
CGCAGTACAACCTGATGAACGTGATGAAGGACTGGATGATCCGCTTCCTGGAGAAGCACGGTTTCTGGGGCGTGCTGCTCATGTCGGCGTGGCCGAACGT
CGCATTCGACCTGTGCGGCATTTGCTGCGGCCACTTCCTCATGCCGTTCTGGACGTTCTTTGGCGCGACGCTAATCGGCAAAGCGCTCATCAAGGTGAAC
CTGCAGGCCGCATTCTTCATCACGATCTTCACGGACAAGCACATGAAGCAGGTCGAGGCGTTCATCGCGAACGTGACGCCGTCGGCGTGGCGCTTGGACT
CCAAGGTGAGCGAGTTTTTGCTCGAGTGCCGCGAAAAATTCCACTCGGCGCGCGGCCAGGCTGCGGTCGAGCACGCAACGGGCGAAGGCGCCAAGTCGAG
CCTGATCTCGCAAGCTGGCTCGCTCGTGATGGTCGTGTTCATCGGCTACTTTGCCGTCTCATGCATTGAGCAGTTTGCGCAGCAGCACGCGGCCGAGGAG
GACGAGAAGAAGCTCAAGAAGCATAAGTAG