Transcript Name :
Pytir_DAOMBR486snap_masked-pir_contig_1-abinit-gene-0.92
Orientation:
(-)
Number of Exons:
3
Description :
Nucleic acid binding protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Single-stranded nucleic acid binding R3H10.798PS51061
SUZ domain9.377PS51673
HmmSmart predictionP-Valprediction_id
Single-stranded nucleic acid binding R3H9.1SM00393
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
SUZ domainIPR024771
*** None ***
InsideOutsideTMhelix
1-465
NN-scoreoddsWeighted Score
0.773.1420.006
PositionContextScore
318GRGRGGR|GA0.587
TypeScore
nuclear696
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
*** None ***
*** None ***
Sequence
        1505 bases(100 bases per row)
ATGCTGCGTGAAGAGCAGGATCATGAGCAGCAGACTGTAACAGCCAATGCGGCGTCTCTCCTGCTGCCCCCGCCAGGCGCGGACAACGACGACGACTGGG
AGACCCAGGAGGACCCGAGTGCGCGCGCCGTGGTTCTCGCTGCAACTGCAAAGTGCGTCGACGCTGCTGCACAAGCTCTCGGAAACATGCGGATCGTGCA
GCCGCCACCGCTCCCGGCGCAGGATGGAGGCGCCTACGAGCGCGTGCTCTTTGACCCGAGTGGCGGAGCGAACGCGCAACCCGTGAGTGCCGCGACTGCA
AGCGCCGCCGCTGCGTCAGCGCTTGATGGCACTCGCGGACCCATGGACCCCGTCCTGGTCGCATGTCTAGAGAACCCGCGCGAGCGCTTGACGTTGCTCA
AGTTCGAGGACCAGATCGTGCGCTTCATCAAGAACCCGCGCGAGTCGCACCTTATGTTCCCTCCGCTCTCGTCGTACCACCGCCTGATCATCCACCGCCT
CGCCGAGCGCTGCTGTCTCGAGCACCAAACCGCCGAATACAATCCGTATGCCGGCGGTTATGACGGCAACTCGTCTCGCGTCGTGACGCTGTTCAAGACC
GCGCAGAGCATCGTGCCGAGCGTGCTCTTGATCGACTTGTCCTCAGACCGGCAGCAGCAGACCGTGACGCCGGCGTCCGCGCCAAAGATTATGATGCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCGCGACCAGGTGCGAATGGCGGCAAGAACCCGGGCGATGCGAAGAACTCGCAGCGATCGATGCAGGACCGGGAAA
AGGCGTACGCAGAGGCGCGCGCGCGCATCTTTGGAGAAGACACGAGCTTTACTAGCACAACCGAGTCGCCGTCGTCATCGTCATCGACGTCCACGTCGTC
CAACTCGCCAGCGAACCCGAACAACAGTAGCAGTGGCGAGCTTGCGGTGTCATCGAGTGCAAAGGCGTACAACAGCAACAACCAGCAGGCGTCCGGTCCT
GATGGGAGCCGCGGCTTTGGTGGACGCGGACGCGGCGGCCGAGGAGCAGGAGGACGCGGATCCGACCGAGCGACAAATGGACAAGATCGATCGTCCGAAT
TTGACCGGAATGCGGACGCAAAGCCGCGACCTTCGTCATCGGCCCAGACAGAGAACTCCGTCGCTTCGTCAGGTGGCGCCCCGAAAGTGCAGAGCACACA
GGACTGGAAAGAGAGCAAAGTGCTCTGGCGGAACCGCGAGCAGGAGATGAACGACCCAGACTTTACGCGCAACCACAACGCGTACCGTCCGTCGCGCAGC
AACAACAGCAATGCCAACGATTCGAACGCGTTCAGCAGTGGTGGTGGTGGTGGTGGCTACAACCGATATGTTCCTCATACGCCGCCGCAGCAGCAAATGG
GCCGCTACCCAGCGGCGCCGCACATGGAGTTCTACAACCAACAGCAGCAACCGCCGCTGCCTGGTCGAGGACGGTTTCCGCCTGGGAATGAGTACAATAG
AATAG