Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-0.41
Orientation:
(+)
Number of Exons:
8
Description :
Inositol-3,4-bisphosphate 4-phosphatase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-12
788-806
864-874
973-1005
33-764
827-840
898-949
1029-1949
13-32
765-787
807-826
841-863
875-897
950-972
1006-1028
*** None ***
PositionContextScore
1299ERARHAR|VS0.607
1534RSQRSRR|TA0.728
1856ESSRLCR|LL0.566
*** None ***
GO
*** None ***
KO ID
K01109
K01109
*** None ***
Sequence
        6482 bases(100 bases per row)
ATGAGGCGGGTACGTGACCTCAATGGCGATGAATGCGCGCGTGGATGCGGATATGTGGCGCATGGCTGGGGGTAATTAATGAACAGGCCATGTATGGGTG
TATGTGTCTCTCTATGTTCGTCTCATGCAGCAGCGCAGTGGACCACGCATGGTTCCGCGACGAGCGCTTCTGTGCCTGGCGACGGTGGTGGGCACAGCGC
TTGTCGCTGTAGCAGCAACGCGCACAGGTCCGTGGCGTCTTCTTCTTCTAATTGCCTCTCTATATTGCTATATTGACCATGTGGGAGTGGAGTGAGTGCT
GACGTGTAGTTGGTGTGTGTGGGGCGAAAACAGGTCCTCGTGAAGAAGCACGCGATGGCGAACTGACAGTAAAGCTCGCAGTTAAAAGCGGACGACACGA
CTTCGAGAGCGCGGATGGATCGACCGATGGAAGTGGTGCGGATCTACTCGTTATTACTATTAGTACTTATACTGCGCGCGAGGAAACCTATACTGACTTG
AGTTGGCTTGTTGTGCTGAACAGGATCGCTGTATGGAGAGGAAGAGCTTAGTTTATGGAGCTCCTTCAGCTCGTCTGGCTCGGAGAGCGGCTCGGGCAGT
GCAGGCCTCGATGAAATCACTTTTCCTTATGACTCGTCTGCGTCGTTCTCATCGTCGTCTTCGTCGTCGTCGTCGTCGCACTCCGATGTCGAGGTCGGAA
ATGAGGCGGGATATGCGGGAAGTCAATCGATGGATGGATATCAGCCACCAAAGTCTTGGTCTGGACCTTTCTACGGCTCAAGCTCCAAGCATGGTCACGG
TACGGACGATATCAGACCCCCGAAAAAAGAGGATCGCGATCTTCCCGACGGTGACAACAAACCAGCTCCAACCCCAGCCATGACTTCTCCTATCCGTGCC
AGCTCGACGATGACTGCTCCAGCGTCAGCCAGGACTCCAGCACCACGGACGACGAAGCCTGTGTTCAATAGTAGAAACCCTGTCTTGGAAGAGCGAGCGC
AGCTGGACGCACCTGTTCCAACTCTCGTGGTGACACAGAAACCTGCTACATCATCTTCCGGAACGCTGAAACCATCTTCTAGCACACCAACTCCAACGCA
GACCGTTAGCGATGCGTTCGCAGCAGCGTGCACAGCAGGCGCTGCTGGCTGCGTTACCGTCGTGAGCTCAGACGTGAAGACGTTATCAATTGTGGCAAGC
GACACGTCTTTCGATGGATCGAGCAGCTCGGATAGTGCGCATGAGGAGAGCGTCATGATTATCGTGGACAAGAAAGCGTCTACTCAGAACTCCGGCTCCA
GCACCGTGGTCACCCCGTATCAATCTAATTTCTGTCGCTGCAAAGTCACCGAGTGCCAGAATGAATATCCCGGAAACTCTACGATGCTGCGTCCGATGTG
CGAAGCCTCTACCGCCGGAACCTGTCGAGCCGGTTACAAGATGTGCTTGTCGACGACTTCGTACAAGCTGCAGGTTACCCCGACGACACCGAACAGTGTT
GCTGATATTACGTTCACGTTGCTGGCATCCGACATCATGGGGGCTTTCCACAATCTAGGGGATCAGAGCCCTATTACAAGAGCGAGCAAGTGGTGGGTGG
CGATCAGTCTCCCCACGAGCTGGAGATTCGTGACGTGGGAAATGACTTCAGTCGAAGCCACTCTGACTGGTCAGCTGAGTAAAACTGATATTTCCCGGGC
GTACCAAGTTCGACCGTGCAATGCAGTGACGGATGCGTCCAATTGCCCAGATCAAAACTCTACCCAAGTCGGCTTCATGAACGTAATGGAGCTGTTGCAG
GACAGACAAGATCTGATGTCGTTGGTTTCGAAAGCGCCAATTTTATTCAAGCTGACGCGAAGTGTCATCACCGGACCTGATGGGAGCTCCAGCTCATCGA
GTGTGGGGATCATCTTAGCGTACGAGAAGATTTCTGGGGCGCTCGGATCTGCGTTCTCAACAAGTGGAAGAAAGATGCGAGAGCTGAGCGTCAACGCCGA
CTTGACAACAGAAATGGTTGCGCTTTCTGGCACCAACCTCGGCGCCTTAAGTTTGGCAGCCATGGATGTTCCAGCGATCCAAGACGGAACGGTTCACTCA
TCCTTGGTTTGGGTCGACGGCGACTCCAACACACTCACATTATCGTTCTCGACATCCACTGTCATCAGTCTTGGATCCGTTGACCCTAAGGTGTGTGTCA
ACTTGCGATCATCGAGATGTGGTCGAAAAGGTCGCCCGACAACCTCCAATGTGACATTCGAAGACCTCGCAAGCGCAGCGTATATGAAGGATGGAAACCC
GTTCATCAACTTGTATTCATCACCTGGAGATGTTCGACTGGAAATCGACTCTGTCAACGAGACGTATTTTTGCGTGAAGAAACTGCTTCCGTCAGGTGCT
GGTGCGAACAAGTCGTGGGAAATCAACACGGACTTCACCTTCCAGCTTCAAGTCGCTGGCGTCATGTGGGTGAAAGGAAAAGAGGTGAACACAACAGCGA
GATTCCGACTGCCTCAGCTTGCTGAAATCTCCCTGATTGATCGAGAAAGGCTACAAGGAAGTGACTGCGCACAGCTGCTGTCCCACGAATCTACATGTAC
GTCTGCTCTCACTCTCACTTTAGCTGGCTGAATTTGTCAACATCTAACGAACCGTTTTCTGTACTGTAGATTCCAGTCATGGACTTAGTATTTACAGTGT
GATGTCCGTGACGATTTACTCGGTCGCTCTCGTCGGGGCGATTCTCATCACGCGAATGGTAAGAAGAATGCCTGTTTGCTTTTGCGTACCAGGCTGTGTT
TGAGTCATGATGCTGACTTTGATTTTTCATGTAGAATGGCGTCACGTTTTCGGCAGCGACGTTCTTCAACGACATGACCTCAGTGTGCGTCGTCCTCGTG
TTCCTGATTTCCATCGTTGGCAATGCGATTTGGATCCACGTGTCGTCCAATGGCCAAGAGACCAACAGCAGTCACATCTACTATCTCCTGCGGCAAATCA
CGATGTGCTGCACATGGACGATGATGACCTCAGTCTGCTTCCACTGGTTGAGCGTCCTCAACCAAAGTGTCCGAAAGCTGCGTCGTGTCTACGTGCTGCT
GGCGTTCATGCTGATCAACGGGGGCTTCTACACGTACGGATTGTACGGCATGATCTCGCTGACCGATTTTTTCAAGTGCACGTACAACGACTACTTGAAG
AACCCGCGGTACAACCATCGTCTCTGTGACAGCGACTACTGTCCAGACTTGCAGCCATACCAGTGGAAGTATGCGACCCAGGAAGTTTGCAAATACGTGC
ATGATTCTTCGTGGTATTTCGCTGCTGTATTCGGGGGTGAGTTGATGATCTTCTTCACAGCTATCGTGTTGCTGGTGTTGGGCACGTACGTCATCCAGCG
CGGTACTCGTCTTATCCAGCAATCAGGTGACGTGTTTGATGAGAAGATCGTTTCGGTGATGAGGAAGTCGCTGCGAACGTATCTAGCTGTTATCCTTGCG
ATTTCATGCTCTCTGGGTGTATCGAGCATTTTGAATTTGGTGCTGTACACTCAGAACTGGAAGATCAACGCCGTCGTGTGGTACACCTTCACGATTTGGC
TCCCAACGCTGATCCCTCCGGCTGGCTTCCTTGTGCTTCAGTGGAACCCTCGGCTTCATGGCATGAATTGGAATCCATCTCTTCATGTCAAAGACCGCTC
GGCGACGAAAGACAATCTTGGTGACAAGAATCCAATGTTCAATGACGACCTTGTCAGCGATACTTGGACCGGTGCCTCGAACTTCTTCGATTCCGAATAC
GTTCCAATTGGTGCGGACAGTATTGAGGGCAACCAGAACATCTTGGCGTTGTCGGTCCAGCTCGTCTCCAAGGTTCCGATTGCTCACGCTTGCTTCATCG
AGCTGTACGTGACTGAACTCAGCGAGAACGATGTTACCGGTGAAGACGTGTTCGAAGACCTCCCATCGGCAGTGCGCCATCGATCAAGCATAAGCTCTCT
TCTTCAAACTGGACTTCAACAAGAAAGTATGAAGTACCGCCGTGGTCAGTCACTGTCCATGAGGGCATCGATGATTGGCATGAACAGTTCGCAATGGGTC
CGTGTGGGTTTTACCGAGACGGTGCTGCCAACTTTGGTGCAGAGCTCGTCGACTGATGGCTCGATGACGACCCAGGTGGCTACATTTTTGTCCGTGTTGC
AGATCCCGGTGATGCCGACAAACCCAGTGCTGCGATTTGTGGTGTATGAGTTGCCTGACGGAATCGTGGGCGCTCAGAATATGGATCGATACTCGGAAGA
CGCCCCGAGTCTCATGAGATCGTCTTCGATGCAACTCGACGAACGAGCGAGACATGCGCGAGTCTCTGGCATGGGTTTATCTCCACCAACAAGACCGCAA
GTATTTTGTGAGTTTACCTGCTCCTCTAGCGAGGTGCTTGCCTCTGATGAAATGAATCTGATTGCGCGTGAAGGATCCCATCGTCGCTACATGGCGAACA
ACATGCCGGAGTCGTTGTCAGCACCTGAAGACGCTCCGAACCTCCGAATCAAGTCCATGACTGTGTCGACGCGAACGTTGAAAGAAAACAATGGCTTCTA
TGTGACGAAGAGCTTCCAGTTTGCTGAGGGTAACGAGATGGTTGTCGAAGACATGACTGAGAGCGTTTTCACGAATGAAATTCCACGTCAGTACCTAGAG
CTTCTTCGCGCAGAGCGAGCTGAGGACCTGAACCGTGCGAAAGCAGAGCTGACAAGCTTCGAAACGAAATGCAAGACTGGGCTGATGAGCGGATTGTACG
ACAACCTCATCGACCAAATCCAGGTACATATTTGCCCTGTTATGGTTTTGCTGTGTTGTACCATCATATGCTTATTTTTGATTCTCTTGACTGTTTATTT
TTGCAGGACGAGAATGACCAAACTGTTGTGCTGAAGTGGTTGGAAGAGCGTGTCCAGCGCCGTCGACTGTATGTGGATGCCCTGCGCGATTGCCATCAAG
TATGCATCAATCGAGCAGAAGAAGGAGTCAACTACAAGGCGAGCACAGAGAAGAAGAGCGCGCTGCTTCGTTTCCTTCCAATCAACCTGGTAAGTATTGG
TATTTTCAAAGCAAATGTCATGCATTCTTTGTTTCTAACGAACTAACTAATTGCCTGCGTCACCGTTTCAACAGCATGTGCAAGATATGTGGGTCGGACC
AACAGCAGATCTTCGTTCCCAGCGCTCGAGAAGAACAGCAAGCACTGTCAAAGTGTACCCAACTATCACTGTCGGTGCCTTTGCTGCACACTGCTTCAAG
TTTCGCCACGGTGGCAGCATCCTGAGCCTACGAAGCAAGTTGCAGAAGCGTACTTTGTCTCGCATTCAAAGCGACGTTTCTGATCGTGGAGGCAGCGGTA
GCACCGACACTGAGCAAGAGGACTGGACGAAGGCGGATCTTCGCTCGCAAGACGAGATTCTGTGGCAGCTCACCACACGACTGGACATGTGTGTCTCACA
GGCACTCACAGCACTGGTGACTTCATTCTGTCGCAACCTGGAGAAGTCACTTCAGCACCCGATCGATCGCCACTTTCTCCAGCTGATCGACTCGATCGGG
TTCCTTTTCCAGGTTGAGAGTCTCTTGTCGACACAGGGTAAGGAAATCGGAATGCTCGAGGATTTCTCCGCATCGGTGGACGCGATGAAGAACATGACCT
TCGTGCTGGACACATCTCCTCCAAGCCACTTGCCGTCTACGCTTAACCTCCACTTGCGAAACACAAATCTGCCGAGTGTGGTTTCTGTGCGCATCAACAA
GGGAGCAAAGACCGGCGCGTTCATCATCGTGGTCGGAATCCGGTGCCAAGAAGATGTATTGGCGACGCTGCCAGCGAACCTTCGCAGCGGTCGTACGATC
CCAGTCACTCCTGTGCTGTTCACACAGGGAATCAACGAAATGCAGACGCTGGCAAACAACGCGAGCGGCAAGAAGACGTATCTGCAAGATACGATCAACC
AGAAGAGCTTCCGCGTGCTCACTGCGTACATTGAGGAGTACAAGAAACTCGCGGCTGTGAGACCGGATGCAGTGCCAACGCCTGTGTTCACGATCACTCC
GCTCTTAGCGTCGCTCGAAGATCGCATCATCGCCGCTCGCAAGCAAGTCGTGAAGACCAAGCACCCGAAGATTATTCAAGAGAGCTCGAGACTCTGTCGT
CTTCTCGGCGCTGGTCGTGTCACTTCGTGCAAGAGCGCGAAGGACCGCACGGGCATGTCGGTGACGCTGGAGCAGATCCAGCTGCTCTGCGACCATCACG
GCCTCCCTCAAGAGTTTGTGATCCGCACAGTGTCGACCATGCGCAGCAACGGCGTGCGGCTGGAGAACGCGTTTAAGAACACTGGCAAGCGACAGTACGC
GTTTAATGCACTCCAGCGGTCGCTGCTTCCCGAGGAGTACAAGTGTCCAGAAGGAACCTACGGACGTGGCCAAGTGAGCTAG