Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-fgenesh-gene-1.15
Orientation:
(-)
Number of Exons:
2
Description :
Nucleolar pre-ribosomal-associated protein 1 (Protein URB1)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-2108
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        6432 bases(100 bases per row)
AGCTTCGCGCAGGTGCTCGTCCCGTCGTCGTCTACGTCCTCCACAGCCTCCACCTCTGCTTCAAGAGCCGATGATCTGCTGGCGACCAAGTTCCTCGAAG
TTCAGCCGCACGCCGACGCGCTCATGCACACGTGGCCGGACCAACACGGCGCGGGCTCTCGCTGGGAGAAACGCGAGTCCATCGCCGTGTTCTTCCGCGT
GCTCTCGCGCCTGCTGCGCGTGCAAACGCAGCGCAACGCCGGTGCCGCCGAGGTGCTCGCGCTCAAGGTGATCCGCGAAAAGAATGCGAGCCTCGAGAAG
GTGTTGACGTGGAGCGACAAGCCGATCATCGAGTACGAGGCGCTGGAGCTCATGACCGCGCTCGTGGGCGTCAACGGCGCGGTGGCGCGCGAATTTGTGC
GCCTGTTCAACTTCCAGAGCGCACCGTTCGGGAAACTCGCAACGCGGCGCATGAAGAAGCCAGACGCGCCAATCGCTACTGAAGCAGAGAACGAAGATGT
GCAAGTGGGTGTTGCTGCGAAGCCTGCGTTTCAAATTCGAGAGGCGTACGTGCGCCTTGTGCTTGCGCTGACCGCGTGTCCCGACAAGAGCGTGCACCGC
TTCGCTATGAAAGAGGGCGGACTGACCGCCTCGCTGTTCAAGAGCATCGACGGCGATAGCGTCGAGATGCTCTCGCACCTTTTCAAGCGCCTGAAGGAGC
TCGTGCTGCACAACGCAAGCGTGGACGACAAGACGAAATTCGTGATCTTCAATGGCCACTGCGTGCACCAGGTACTGCCGTTGCTGCAGTCGGACGAGGA
CTCGATCGCGCAGATGGCGCTCGAGGTGCTCAACGCGCTCTTCTTCGACGCGAGCGCGCTGTACGTCGTGCCCCAGAAGCATGCGTTGCGACTGTTCTTG
TCCAAGGCGACGGCCGCCGTCGCGACAGATAGCGACGAGCCGAGCCACACATCTGAGCAAGCGTACGCTGTCAAGGTGATTCGCAATGCGATCGTCACGA
TCGGCGTGAACGAGTACATCCGCAGTGCGTACGCGCAGACCCTTGTGGCATCATTCATCACCAAGTACCCTGGCCTCGCGGCCGAGTACCTGCAGGCGCT
GTCCATCCAGCTGGAGCCAAAGCTCGGGTACCGCTGGTTCTGTGTCGCGTCGCTGGTGCAGAAGCTGCTCTCGTGCCCTTTGGACGCGATCACGGCGGGG
TTCCCAAAGGAGAGCGGCGCGGACGTGCCCTCGTGGTGCTCGTCGCCCGCGCTCGCGACGCGTTTGATCCTGCCGCTCAACTGCCGCAAAGAGCTCTCGC
GCGGCATCCAGCACGCGAACAACCTGATCATTTACAGCACGCTCGGCGTCATGGAGGCCGCGCTGAGACGGTACCAGTTCCTCGTGTCGCTCGCGAAGCA
TGGGGATACACCGGCGATCTCGCCCGCCGAGCTGGAGAACGAGCTGCGCTTCTTGCTGCCGAGCCCCGAGGCGCTCGTGTCGCTGCTGCTCAAGCTCTGC
TCGTCCGTGGACCAGGTCGCGCTCATCTACGTGCGCGCGCTCGTGGTTTTCCGCCTGTACCTCGAGTGCCTCCCGCAGGCCATGAGCGAAGTGAAGCTCG
ACTTCACCAAGATCCTCGCCTGGGGGTACCTCGAAAGCAATACCAACAGTGAGAACAAGCCACGATCGGCACTCGCGAGTCTCATTGTGAGCGAGATCCT
GCGCTTCTTGCTGACAGTCGATGCGAACCGACTGCACGTGCTGCTGCCAAGCGGAGCGCAGAACAACAACAGCAACAGCAATGCGCCACGATCCAAACTG
CTGCAGCTGCTTACTCTGTACGTGCAGACGCCCAACCAGGCTATCCAGAAGCTCTGTGCACAAGTGTTGCAGCGAACGCTGCTCATCTCCACGGTTTTTG
GGAACGACACGACTGGCGCTCAGCAGACCAGTCGCTCCGATGAAGAGACCGCGATTTGGCTCGACTCTTTGCGCGCTGGCGGCGGCAAGTGCGTGGCGTT
CATGGAGAAACTGGTGCAGAACGTGCTGGCGGATCCGTTCCGGTACCTGGAGACCTACCGTGCTCACTCGACAAGCAATACTACTAGCATCCAGGCATTG
TCGCTCAGTCCCGGAACCATCGCGCTCGTGACGTTCCTCAACCAGCCGTCATCCAACGAAAGTGACGCAAAGAGTGGTGGTTCTCTGGTCGCTCTCCGCT
CCGAGGCGCAGGTCGTGGTGTTTGGCACGCGCGTGCTGCTCTCGTTGCTAAGCACCGCTGAAGCCCCACAGCAGCTCGTCTCATTGATTACGAATATTCG
TAGCGCCAGCAGCAACGGTGAAGAACATGCTGAGGAGTCAGTAGAGCCTGAGGGCAGCGACGCCGCGGCTAAGAAGCGCAAGCGCGCAAATGACCAAGTC
AAGAATGGGGCTGGTGCATCAGACGCCTACGAGCACCTTGTGGAGTACTGCGAGGCGATCTCTTCGAGTGTCCACCTGACTAAGACACAACCATCACCAG
CGTCAAAGAAACTGAAAGAGTCCAGCAATGATGGACACAACGCCAAATGGGCTCCAGCGAAAACCACTGGTGAATTTACCACCCAGTTGCTCTCACTTTC
ACCTTCTGCGTTCGTCAGTTCGTGGGAGCAGGTTGTGGACAACTGCCTCAAGGTCAGCGGTTCATTCGACATTATCTTCCACTACCTCGGCTCGTGGGTC
GGCGGCGGCCTGATCAACATTCTTCAGATTTCTGCTGGTGGCAAGAAGCGCCAGTTGTCCAAGACGAAGGAAAACGCCATTGGCGAGCGCTTCAAGAACG
AGCTGCCGTTGCACATTGTCTTGCAGAGCGTGCTCTTCCACAACAGCAATTCCGCAAACGCTCGGGACGTGATCGCAACACTAGCTGTGATCCTCAATCA
GCGCATCGCCAGTGGCGCGTTGGAGATCACGGAAGCTGTGCGCCTCTGTGAGCAGCTCCTCTTTGCACTGAACAACAGCAGCAGCAACTCCAGTAGCTCT
CTTGCGGATGAAGATGTGTGCAACCTGCTGCTCCATGTGCTGAGCTTCGTGGTCGTCTCTGCCAAGAGCATCGACTCGCCGCTCCTGAACTTCCAGATCG
CACGCATCCTGCGTAAACTGAACGGCGCTGCGAACGATGCTTCGTCGACGTCGTCATCATTGGGACGAAAGCTGTCGGCGCTCGAGATCTCGGGCCTTCG
CCTGTTTTACAGTGAGCGAGAGAGTGCGTCGTTCAAAGGTTCGTTGTTTGCGTCGATGCTCGAGCGCTCGGGGATCCCGTCGGTGGTGCTGCTCTCGTCG
CACTTCCCAGCGGATCTGCGTATCCGCCTATTGCACAAGTTCTTGGACTCGACTTCGAGGTCAGCATCGTCGTCTGTGCAGGACGTGCTGCTGCAGGACT
TGCTCCAGTCTCTGGACGATGAAAACGCGACCAAGACCACGACAATCTACGAATCGTTCTCGGACTACAAGAAGAGCAAGTTGCTGGCGAGAAAGCTGTG
GGAGCTCATGGAGCGCACGGGCTTAGCCACTAGCAGCAGTGCTAACCGAGACTCCTTGTTCTACTCGTCCAGCTTCTCAGTGCTGGGCAAACTCGGTGGC
GTTCAGGCGGACGTTGCCCACAAGGCGATTGACAGCACGTTGGTTCCTATCATTGTGAGCACGGCGTCCAGCAGCAGCAGCGCTGGCAGTGTGTCTCTGC
CGGAGATGCTTCGCCGAATCGTGCTGTCAATTCGCAGCGACAGCTCAGTCACTGGCGCTGTGTTGTCCCAGTTCTCTCGTGATCTGGAGTCAGCGCTCGT
CAAGAAGCTCCAGCAGACCCCAGCTGCTGCCGACAAAACGGTCTCGTACTCGCTGCTCAGTGCCGCATACGACGTCTTCACACGCATTGAGTCGTCCGAG
CTCCTCGCGTACGCCCACACCCTGGTGGGGGACTGTTTCGTACACTTGATGCAACATGATGGTGATGAAGCCACCCAGTCGCTTCGCCTATCGTTCTTGC
GCCACGCTCTGCTGGACAACCTAAGCTCCAACGACCTCGCTCCAATCGTCTCGGGTGTGTTCAAAACGCTCTCAAAGCAGCACCCAGACGGGAAGATCTT
GTCAGCGACCCAGCAGGTGGCGCTGCTGCTTGTCATGCGCTCCAGTGGTGCTCAGAGCAGCAAGACTCAGGAAATGATCGTGGTGTTCCTCGTCAAGTGC
GGGCTCCAGGAGTTGAAGGCGCTTTCAAAGGCGAAGAATGTGGACGATGCCTCCCAAGAAGCTGCAGAGACCGACAAGTTCCTGGCTGCCATTACCATCA
TCGTCGACGGTGTCATCAACAGCAAAGGCGTGTCGCCATCGACTCTAGCTGCGATCCTTAAGACGCTAAGCCCTCAGTTCGCGAGAGCGCAGGACTACAG
CTACAGCACCGTGGCTGCGTACATGGGCTTTGTGAAGCTGAGCGCCGTGTTCCTCAAACTTGTGATCGCGGATGAAAGCGCGCGCAAGGCGACCAAGTAC
AACTTTAGCGACCATCTGAGCGCGATCACCGAGAACCCGCTGTTCGTGCAGTGCCTAGAGGACAAGCTCGCCAACCCCGAAACCCCACTGGCGCTGATCC
GCGTGGTCTATTGGCTCGTGCAAATGAGCAGTGTGTACGACCGCAAGCTCTTCAAGGTGCTGCTTAGCGTCTACGCGATGTCGCTCAGCGCCTTTGACCG
CGTCCTGCGCATCCTCTTCGAGAAGTTTGACGAGAACGCGGGCATCTCGCTCTCTCAGTTCGGTTTCCGCTTCGGCTCGTCCTCGACGACGATCTTATCG
GCGGCCGAAGACGCGGTCGAACCGGGTCAGTCGCGCGTCGATCTCGTGGACGACTCGGTCTGGCTTATCAGCGGCGGCTTGGAGCAGACGCGCATCCGTG
CGACGGTCGAGTACTTCCCGCTCGATCGCGAAGTGGCGACGACTAACGACCTGGCGCTGCTCGCCTTCGATGTCGAGAGCCTGAGCAAAGCACATGAGCA
AGACGCGAAGAAAAGTGCAGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTACGACCCGGCGTTCCTGCTGCCGATGCTGTCGCATTTCATC
TCATCGTCGGATCTTCCAGACGCCGCAGTCGTGCAGCAGGGGCTTCTCGGTATCGCGGTGCGCGCCACGTCGTCAAACGCGGACTGCATTCGTACCTATG
CGTACGGTATTATTGCGCACACGCACGAGTCGCTGACGTCCGAGTCATCGGACTTCAAGGCGGGACGCCAGATCCACCTGATGCTCGAGAGTTTCCGAAA
CTCGATCCAAGAGCCGCTTGAGGGTGTGTCATCGGTCATCACGGTGTTCATGAACGATGCGATCTCGATTTTGTGCCGTCCTGTGCATGCGATGTATTCG
CACTTGAACCACTTCCTCCTGGCGCGTCCGGCGATCGACGTGAACGACGTGCCGATGTTCTATTCGCTCTTCAACAGCCGAGCGCCGCTCACGTACAAGC
AGGAGCGCTCGTGGTTCCTACACACGCTGCGGCGCGGTGTTTGTGAAGACGTGGACGTGATGTTGCTGGTGCGTCGCCACGTGCTGCCGATTCTCATGAG
CTTCTTCAGCTCGGAGCTCGCGGATGAGCACACCCAGGTGCTCATCGGTCAGATCTTGAACTCGTGTTTGAAGACTGAAAGCGGCGCGTTGTACTTGATC
TCGAAGGCCGCGTTTTTTGAGTGGGTTGGCGCTCTGCTATTGAAACAGCAAGCCACGGAGAAGAAGTCGCTGCTGCTTGTGATGGAGCTTTTCAAGAACG
CGCTCAAGGCGAGCGAATTGCTCGTCGAGGAGCTTGACAATGTGCAGCAGCGAGCGCTGTCCCTGCAGACTGTGAACTCATTCGCCGCGCTTTGCTCGAG
CGTCCACGTGACTCGAGTCGACGCTGCGTTGAGCGCAAAATTGGCGCGCATTTCGGAGCTGGTCATGCGTTTCGCCCAGTCGGCGTGCTCGCTCATGACG
ATCCAGCATGTCGTCGAAGCTGTTTCGCGCTCCGTGAGCTTTATCGAAGCTGCTGAAGCAAGTGAGGGTTCAAGCGAAGTTATTCCTCAGAAGATGTGCG
ATGCCAAGGTGAACTCAGTATTGAACTGCATGGAAGCCATCGTGAGCGAGAAGCTGCTGCAGCACCCAGATCTCCACAGGCGCAGCTTTGGCGAGTGGGC
GGGTGTGCTGAGTCAGATCGCGGACGCTTTGGCCGCATTGATTTCAAGCGAGCAGAACGAGACGACTGTCGCGGTTCCACTAGCTGCCTCCGTGTCCAAC
ATTGAGCAACGACAGCGCGCGAAGATCGCACTTGCGAGTCTGAAGGTCGTGCTAGACCAAGTGCCGTTGCTGAAGCAGCAAGTGCTCGCGAAGGCGTCGC
TCACGAAGATCGCATACGCTGCGTTGCTGTAA