Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-1.27
Orientation:
(+)
Number of Exons:
1
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Sterile alpha motif domain12.98PS50105
HmmSmart predictionP-Valprediction_id
Sterile alpha motif domain1.2SM00454
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-588
NN-scoreoddsWeighted Score
0.7142.9540.006
*** None ***
TypeScore
nuclear739
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1767 bases(100 bases per row)
ATGCTCAAGCCGCCGCTCTCGTCAACCAGCAATGGACCGCACTCGTCCGCGTTCTTCACGTTCGAGAAGCAGGCAGCGTCGCTCAATGACCTCGATATTG
TGCGCAAAATCGTGGAGCGCGAGGGCTGCCTCGAAGCGCTCGCCCAGCTGCTCACGACGGCAACCAAGACCAAAGGACCAACAACTTCAACTGAGATCGA
CCAGGTGTACCCGTACACGTACCCACGGAGAGGCACAATAACATCTTCAGCCGGCAGCAGCTCTACGGCGTCTCCCATGGTGGTGCACAGCCTGCTCGAC
CAGTTGCGGTCTGTGAGTATCCAGATCGTCGAGGCGATCAAGCAGTGGCGCGCGACCACGCAGTTGCAGGTCTTCCAGTGGCGCCAGGTCAACTACTTGC
TGAAAATGACCTCGGATCTCGACTTTCTGGCGACCACCGCTGTACACGTGGACACGCTGCAGCAGCTGCCGCGGCTCGAGCGCAACCCGTTCCTCGCGCC
GCTGCATCTCGACCACCCGGCATTGCGCGAGAAGCTCCCGGACGCCGCGATTCAGCTGGGCGTTTACGTGGGGACCGTGGACATGAAGCGCGTTTTTTAC
GCGTCCAAAGTGCTACTGCGAGAGCTTGAAATGGAGAAAAAGAAGCAGCTGGTGCAGAAACAGCAGCAGGGAGGCTTGGACGACGATGAAGACGATGGTT
ATGGCGCTTTATCCCCAATGAACGGATTGAACAACCCCATGGCTGTTGTGGACCCGTCGGTGCTCGCGGCGTCAAAATACCAGCCACAGCAGCACCAAAT
GCGAGTGCACTGGAGCAACCAGGAGGTCAAGGGCTCGTCCGCATCCAGTCTGTCCTCTCCCTATCCGGCAAAGCAGGCTCTATTGCTTGGGAGTGACAGC
AGCACTGCTGAGCCTCCGCCCCGTGACCGGAAAGAAGCGATGGGTCGGGACCTGGAGCTCTGTCGAGAGCTCATTCTCCACGCAGAGCACGAACTAGGAG
CGATCCGAGAGGAAGTGGCAATTCTGCAGGAGAAACTCGCTGACACGCTCGCGCGCCCCGAGCGACGACGCAAACTGCAGAACAAGATTGGCGCTCTCAT
TAACGCACTCAAGTTCAAATCTGGCGACCTGTACCAGCGCAAGAACGAACTGCGTCGAAAGGAAGCCGTCTACAGGCTTCAATGTGAGCGCAGTAGTGCT
GGTAGCAGCAGCAGTGGGAGGATCGGTCGAGTTGATAAACTGACGAGATCACAACGGGCTTCCTCCGGCAGCGCAGCTGATCAGTGTGAAAATGGACGAA
GAACCCCCGAGTCATCCCAGAATCTCCATCCGTACCTGAGTACGGTGGAGAGCGCCATGCAGGAGGACGAGCTGCGTCGACAGGAAATCGTCGAGAAGTT
CATGACGCTGGCCAAGATGCGTGCAGTCACAGCAACCTCTTCAACGTCCCGACAAAAGCACAAGCAGCAACTCACCAGGAACGCCAGCCATCCGAGTCCA
TCGTTCAAGCTCCATGCCACCATCGGCAGCTTCAGTCCACACTCACAAGCCTCAGGGCAGCACCTCATGACCACTGACGAGGTCTCGACTTTCATTGACT
CGCTAGACTTGGGCTGCTCGTACGGAGCTAAGTTCAGGTCCCAGGGCATCGACGGTGCGCTGCTGCTCCAGGCGAACGACCAGGATCTGGAAGAAATCGG
CGTCACTATTCGCCTGCACCGCGTGCGCATCCTGGAGGCGATCGCGAGCCTCAAGGCGTCCAGATAG