Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-fgenesh-gene-0.5
Orientation:
(+)
Number of Exons:
1
Description :
GF13390
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
HTH CenpB-type DNA-binding domain13.069PS51253
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
HTH CenpB-type DNA-binding domainIPR006600
*** None ***
InsideOutsideTMhelix
1-381
*** None ***
*** None ***
TypeScore
nuclear565
GO
*** None ***
*** None ***
*** None ***
Sequence
        1146 bases(100 bases per row)
ATGGGGAAGCAGGGCCATGGGCGGCGCTTGACCGACAAGGAGCGCATGGAGATCATCGAACTGACGCGGGAGAACCCGCGCATCAAGCACGTGGAACTTG
CCGCACGCTACAACGTGAACGAGTCCACGATCCGTAAGTGGCGCCTCACCGCCAACGCCGAGAAGATCGAAACGCGCTACGGCGCAGGCGTCCAGGAAGT
GCGCGACTTGCGTCAACGCGGCCAAGTGGTCAAGAACGCCGAGTTCGACGCCTCGCTCTTTGAGTGGGTCTGCGCAGTGCGTAGTCAGGGCGTCGAGCTC
GCGCCTGTGAAGATCCGCGAGCGAGCGCGCGAGCTGGCAGTGCGCTACGACGGCATGGAGGGCTTCAAGGCGTCATCCGGGTGGTACTACCGCTTCTGCC
GACGGTACGGTCTACCGTGTCCAGCTTCCAGACGAAGCGAAGCCAGCACCGCGAGTGCGATTGCAGATTGCGCTGCGGCGACACTGCAAACTCTGGATGG
CGTGACGACACAGTCGACTCTTGTTGGTGTGGAGGCCACTTTGAAAGCCGGCGAAGCGACTACTATTGCTACTGCAACTTCCGTGGAGAAGGACGAACAA
AAGGATGTCGACAAGCAAGAAGAGGTTATTGAAGTCCAGACGACTGTGCTGGAGAGCTCCGAAGTCATGACCCCGGAAGCTGCTTCGTACGAACCGATTG
CGGAGCCCACGAGTCTCGGAAAGCGTAAATTTGAAGACACGGTCGGCGATGCTCCTGCTGCTGCTGTGTCTGTTGAAGAGGAACACAAAAGTGGAGAAAG
CGTTTCCGTGGGTGAGACGGCTGTACCAGAAGACACCGTCGAGCTTCCATCTCTCGATCCACCCCCGTCACCAGCAACAGCAGCAGCCACACAAGCACAA
GTGGCGTCGCCGGCGATGAGCACTCGGCAAGAAGCGATCTCGCATTTTCTGCGCCACCACAAGCACCTGCTGAGTCTGTCGAGCCGTCTGCGCTTCATCA
AGCATCTCGCGCGTGCTGTCGAGGAAGCCGAGATGTACACGGTCATGGACGACGAGACTCGTGTGGAGTACATCAAAGAGTTTGCCGACAAAAGCGGCGC
CGCCGATGTGCCGACGGGCGTGGTCCGAGAGAGTCTCGTTGTTTAA