Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-1.40
Orientation:
(-)
Number of Exons:
3
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-417
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1561 bases(100 bases per row)
ATGGTGTCGCTCGCGTCGTCTTCTCAGCACTTCCAGCACCAATCGAGCAAGTTACGAACCTACGTCGTGTTAACTGCCAAGTCGTCGGCCGCTTCACCAA
CACGTCGCGCGCGACTCGCCAGCGTCTGCAGCCTGAGCTCCTCGACCAGCAGCACGAGCTCCACGGCCAGCGAGGACGAGGACGACGACGACGACGAAGA
GCTCCAGTATCAGCACCAGCAGCTCAGCAGCTACCACGTGAGCAGTCTATCAGACCCCACGGCGCTCGACTACAGCATGGCGTACGAGTCGTACGCGGCC
GTGACGTCGCGCTACAACAACGCCGGCGCGAACCGCGGAGGCGCGTCCCCACGCGAGCTCCGCTGGAGCGACCTAAACCGCAGCAGCGGCCCACGCGGCC
CGCGCATCGAGCTCTCCAAGTTCCTGAGCACCAAGTCGAGTCAGAACGCGCGCAAGCGCCAGCTCAAGAAGAACGCCAGCAACGGTGGCGCTAATGCTGG
TGCTAACGCTAACCAAAACCAGGACAATGAGCTCTTGGAGATGCACACGCTAGAGCTCTGTCTCGAGTTCCTGGACCTGGACGACCTCGTGAATGGCACG
CTCGTGTGCTCCGAGTTCCACCACGTAATCACGAGCAACAAGCGCCTGCTGCTCGCGCTCTACTCGCAGAAGTGGCGTTCGTCGCCCACTGCTGCTGTTG
TTCCATTGGGCGGCGCGTACCTGAACGCGTCGTTCCCGAGCCAGTTGGCGATGTGCCGCGAGCGCAACACATCCCAGATGATGCAATACCCGCTGGCGAC
GAGGAGCTCCGTCACACAGAACGCCGTCGACGGCACATACAAGATCTACAACAACTCGATGCTGCGCAGCTTTGCGCGCGGGTCGGTGGACTCATTCCGC
GGCACGCAGGCGCTCCCCGTGCTGCCGTGCGCCAAGGCGCTGCAGAAGCAGATCTCGTACTTTGAGGTGTCCATGAAGGGCTGCGGCAGCGTGGGCATCG
CGTCGCTCTCGGATGAGGCGTCGAAGAACGCGTACGGCTTTGGGTCGGAGGAGCACTTGGGCTGGAAGCCCGTGTCCTACGNNNNNNNNNNACGACGGCG
ACTTTGTGTACAATGACGGCTCGGCTTCGTACGGCGGCGAGTGGATGCCCTTCGGTCCAGCGTGGGGTGGCGTGGACGCCCAGAGCGACGAGGACGCGGC
TACGTTCATTGTGGGCTGCGGCCTGAACCACGCTTCCAGCCAGTTGTTCTTCACGTTGAACGGCACGTTGGTTGGAACAACGCCCGTGGCGATCCTCAAA
GGGGAGTACGNNNNNNNNNNCGGCCGTGTCGCTGCACTCATACGGCGACGCGGCCACGCTCAATGTCGGCTCGGCGCCGTTCCGCTTCGACATTGAGGGT
TTCTGTGCAAGTCCCTAGTACTGAGTTTCTGACTTGGTGCTGAGGACTTGCACAGAGAGAAATGCTTTTCGATGGTTTGATGATTTGATGGTCTATTAAC
CCCAATGTGTGTCGCGTTGCTTTGCCTGCATGTTTAGGAAAGGATTGGTGAGTGTGGATGA