Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-1.29
Orientation:
(+)
Number of Exons:
7
Description :
Gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1142
*** None ***
PositionContextScore
15LRLRSAR|SA0.65
182SFSRAVR|SM0.559
745QLVRVDR|SV0.549
903HKRRLRR|TA0.554
1015RERRERR|LL0.611
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3546 bases(100 bases per row)
ATGGACGCCACGCGGTTCAGCGCCTTGCGCTTGCGGTGCGCCTGGATGTGCGTGATGTTGTAGAAGAAGTCGGCCTCCGGGTCGTCCTTGTTGCGCAGCA
GTGCCAGGTCGGCGTGCACGAACGCAAAGCGCTTGAGCGACGCGCTGTGGTCTGAGAGGTTGCCCAGGAGCATCACGAACCCGCGGCGCGTATCTTCACT
TGGGGACTTAAGACTCACACGCACGCACGGCATCACGAGCGACTCGAGCGCGTTCATGATCACCGACTTGTCCACCACCTCCACCGGGTTCGCGTCCACG
GTCTGTGCTGCCAGACGCACAAACGTCGTGAGGCCCGCGAGCGCGCCACTGCGGATCGAGAACTCGCCGTCGTGCATCGAGTGCAGGTACTGGCTCACGA
GTGGTGCGAGCAGGTGTGAGTCGTCCAGGAAGCCCGCGAAGTCCGAGTTGTTGACCGTGTTGAGCGCGTCTACGCGGCGCTCAAAGTCGATCTCCTCGAT
CTTCTTGGGGTCGTAGGCATTCAGCGCTTCGAGGAGCTCGCTGACCTGGGCCAGCGGCATCAGCGCGCTGTGGCTACCGAGCGCCTTGAACACGTCGATG
AGCTTCTCACGCGCCGTGCGCTCCATGATACAGTTTGGTCCAGGTGCGAGCAGCTTGGAGAGCGACAACACGTGCTTCTTCGGCTCTGCGAGCTGCGGCA
CCAGCTGCGCGAGCACCTGCAGGATATTCTCCTTGTCCGCGGGCGTCGGGTGGTGGTTACGCAGCAAGAACGGCAGCAGCAGCTGGAACAGGTCGTGCGC
AGACTTGGGGGAAAGCGCCTTGGCCGCGCCAATGTGGGTTGACAGGCGGCACAGGAACACCAGCTCCTTCTTGGACGAACCCGCGTATCGTTCGACAGCG
TACCGCGCGGTCTTGGAGTGGAAACGCGCGACGAATTGGTCCAAGATGAACGGGATCTCGGGGATCAGCAGTTTCTGGGTGGTTTGTGTGGTGTCATCAT
CCGCCTCCATATTGGCTTCGTCGCCGTCCAGCAGCGATGCCATGAACTGCAGCACCGAGTCGAGGATCTCGGGCGAGAGGCCACGCGCTGAGGCCGCGTC
GACGCTACTGTTCGATTTGTCCGTCTCGAGACCTGCAGACAGACACGAGATCACGCTCTCGATCAGCGGCTTCGTGAGGTGGGTACGCGACGTGGCACCG
CGCGAGATCGCGACCAAGAAGTCGAGCAGCGCAGACGCCTTCGCGGCGCCAACTACCGCGTTCGGCAGATGCAGGATCGCGTCGTTTGAGATCTCAAAAG
TTGCTTCCACCCACGGCTTGAGCGTCACCACATGGTCAAAAGTGTCGACCACTTCAGCCAAACGACGGTACGCGAGCATACGGATCTGCTTACGCATGGA
CGCCGAGTACTCGGGCTTCTTCTCGTCAATGGCGGCGTCCTCTTCTGTGTTCTCCTCGTCAACGTCCATCGCCACGGCAGCAGCGTCATCGTCAGTCTCA
GCAGCAGAGATGGCGCTGTCGGCGTTGAACTTGAGGATCGAGACGAGCAAGTCGACGATTGCAGGCACGTATGCTGCCAGCTTAGTGCCGAGCTGACCGA
CCAGGTCCTCCAGCAAGTTGAGGAAACCCAGAATGCGCGACGGTTGCACGCTATCAAGTGCAATCTCCATCTTGTGTGTACGCTGCGTGACCTTGGCACC
GGCTTTCCCCGAAGCCGACGACGGTGGCTCGATCGCTACGTCAAACGCACGCACGACGAGCTCCACGAAGGACGCGAGCTCGGCTTCTTCCAGCGCGGCG
AGGTACGAGAGGATGGCCGAGCGACGCGCTGCGACCGTGTCGCCCGTGTTGCGGCCCTTCTTACTCACGCACTTGGAGTACAGGAGGCGCATGAGCACGG
GCAGAAGGTGCGGACGGTGCTCTTGGAGCACGACGCCGGCCTCCTCGCTGATGTTGAAGTTCGTGAGCTCTTCGCGGAACGTGGTCGAGTCCGCGATGCG
GTTGAGCTGCTCCTTGTAGGCCGACAGGTGCTTCTTGCCAAAGCAAAAGAGGCACTTGAGCGCGAGCTTGGAAATCACTTCGTCCGACTTCATGATTAGG
TCGAAGAAGAACTCGTGCAGCAGCGCGTTCGCGTACGCTCCTTTCATGTTCTTAAACGTCGAGAAGAGCTTGAGCTGGTCCAGAAACTTGGTGCGCACGT
TCTTCGTTGTAAGCTGCGTGTAGTTCTGCTTCTGCTGCCATTCGGTGACCTCGAGCGTGCCCGCAGTCGCGAGTTTCTCGAGCGCCTGGTCGACGCCCTC
GAGGATGCTCGGGTCCAGCTCGTCCGCGTAGATCGCAGCGTACTGGTCACGCAAGAACACGAGGAAGAGCGGCACGATGAACTTGGTCTTGGACTCGACC
AGGTCGCTGAACTTCTCCAGCCCTTTCCACAACAACGAGTGGTGCGTGCTCAGGTCCGTGACGCTCGAAGGGTTGATCTGGCCCTTCTCCAGTGCGCAGA
CGCTCGCGAACTCGCTCTGGATCTGCTTCACGGAAGACACAGTGGCGTCCTTGTCGGCTTCTTCTTCACTGCTGCTGTGGTCATGAGCGCCGTGAGCATT
AGCTCCCGCAGTCAAGCTCTTGTCTTCCTGGCGCACCGAGGCGGCGAGGAGCTCGGGCGTGGCGATCGCCCATACTTCGGCAAAGTGCACGCGCGCCGCG
GCCTCCACAGCGTCCGCGATGTGTGGCCAGATCGTCGCAAACTTGACGTGGTACAGTCCAAACAAGTGGTTCACGGCGATGAGCTTGTACACAAGCGGCG
TCTGCGGCGAACGGCACAGGATCTTCACGCGGCCGATCAAGCGGATGACCTCGCGTTCCGTATCAACGCTCACGCCACTGCACAAGCGCTCGAGGCTCAG
ACACACGTCCGGGAGATCGCACTTGCCCAGCAGCGTGACGTCGCCGGCTTCGATGAACTCGTGGCGGTCGTGACGCGCGAGCAGCTCGAGCGTCACCAAG
CGCAGCTCGTGCGATTGCGAGCGCAGGTTGCTCTGCAGCAACTCCGCGACTGGGAGCAAACCAACTTTGCTCAGCAGTTCGTGCTGCTGGGCCTCGCTTT
TCATCTGAGTGAACTCAAAGAATGCCGAGAGCGTCGCGAACGACGTCTGCTTGCCGCTCAGCGCGCTCACGACAAAGTCCGACGAGAGCTTGGTTTGCTT
CTTTGTAGAGTACTGGGCTGTAGCCTTCTTTTGGTGCTCGGCGATCTGCATCAAACGCCACAATTCGGCTCGGAACGCGCCAAACTCGGCGACGGTTTCT
GCCTGCGGGTTCTTCGCCATCGCCTGCTCAACCTGCGCGATCGCGGGCGTCACGAACGCGAGCATCTTGTCGTCGTTCAAGCGGATCAGCGCCAGCGCCT
TGCAGAACTTCCACGCGAGCGCGAGAGCGGCGCGCTGCTTCTCGGTGTTCGACTCGCTTGCCTGTGTAAAGCACTCGCTCACCAATTGCTTTGCGATCTT
GAGCAAGCTCGCGTCCGTCAAATTTGGCTTCCCCACTGGCGTATAG