Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-0.31
Orientation:
(+)
Number of Exons:
7
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Basic-leucine zipper domain10.381PS50217
HmmSmart predictionP-Valprediction_id
Basic-leucine zipper domain1.1SM00338
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-444
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
transcription factor activity, sequence-specific DNA bindingGO:0003700IEA
regulation of transcription, DNA-templatedGO:0006355IEA
*** None ***
*** None ***
Sequence
        1786 bases(100 bases per row)
ATGGAGCTCACGCCAGAAGACGACGACTTGCTCAGCTACTTCCTCTCGGCGGACGTCGCGGCCGAAGATCTCCNNNNNNNNNNNNNNNNCCGCAGCAGCC
CAAGACCGACGCGCTCAACGCGACGGGCACAGCGCCGCTGTACCCGGCGCTGGGCGGCGGCGTCGCTCCATCATCGACCGGTGGGAATGCGGGCGGTGGT
GATCAGTACGCGTTCGATCGATCATTCGGCGGTGGTTCAGCCAGTGGACAGACAGGTGGAAGCGCCACGAAGACCTCGGCCGGCGGCATGGCGACGCTCG
GACCGCTCTCGACGCTGCAGCAGATGCAGAACGCGTACCACGCTGCGGAGAACGCGATGATGCGCTCGTCGTCGGCGGATGAAGAAGCCATGTCCGGAGC
CGGACTGGACTCGGACGAGAAGCGCCAGCGCAGGTGCGTTGTCGTATGGATGCGTGTAAATGGATGTAACCCCGTGACTGGTCGTGGAGTTGCTTCTAAT
TGACCGGGTTTGTGTCCGTAGACTCGCGAGAAATCGTGAATCCGCGCGCCAGAGTCGTCGCCGAAAGAAGCAGTACTTGGAGCTTTTGGAAGAGAAGGTT
GGTGGTTACTGATTTTGCTTCGAGACATAGAATCCACAGAGAAACCAAGGGCGTGTTATTGACTGTGATATGGATGGTATCATGCTGCCAATAGGTCTCT
CAACTCACAGAAAGCATCGATGCGACCCGTGCGAGTCATCTCGAACGCGCCGACGAGTCGCTCAACAACGTGCGCTCGGAGATTCTGGCAACGCTCTCCG
AGGACTTGAAGAATAACCCGCCAGAGGTACGAGCCATCTGTATGTATTGTTTCCGTGCGTGAATGGCAACTTACTTGCTTATCATGTTCCACAGGCTGTC
TCGGAGAAGATCCGACAGGGTATCATGCTGATTCAGGAGCGCTTTGGACCAAACAGTGTGGTACGTATCAGTCCACGCAAACCATTACCATCGACTAGGC
ACTTCATGGGCTCACACCTCGCAACGTTATGTATTTTTTCAGGAACGCATGGCTGTCAAGGACTACAACTTCCGACAGCTGGACAACTTGCTGCTGCCGC
CATACTCACGCTTCCTGCTGTGGCTCAGCATCCAAGACGAAACCTTTTTCGACGAAGCTAGTGGACTCGCAGCGAAAGCAGGCGGTGAGAACCCGGACAA
GAAGAAGCCGCCTGTTGTCGTGAAGAAAGACACGCTGTGGCCAACTTTGATCGGCGATCTGGCGCTGACGTACGAGCAAGACGAGAAGCTCAAGTCCTTG
TACAAGTACGTTATGCTGAGCCGCTCATATGATGCAACACAGATGGTTGGTAATCTGACAAACTCTCTCTGTCTTTCTCCAGGTCTGGAGACTCCAAAAC
CAGCAAGTCGGAGAGACGACGGATTGCACTCGCAGTGGTATGTATGCTGTCAATTCCCTCACTCTAACCAGCCCTACTGTGTGCTGAACATGGTGTCTTT
GTTTCTCTTTTTTCAGACATATTTAAGCAAGCTGAAGAACAGCCTGGAGCAACGATCGGAGGCCGTGCAGCGTCACACGGAGATGATCCACTCGATCTTG
ACCCCCGAGCAGTCGCTGACGTATTTGCGCTGGGTGGACGCGAACCAAGACCGTCTGCCGAACTTCATCGACCGATCGATCTCGATGTCGACCACAGGTT
CGTCTGAGGCGGTCCGATCGATTCTGAAGAAGAACGATCGGGATCTCACTGTCGAAGACGTGACGGCGCTCCTGGCGGAGCTTTAA