Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-0.33
Orientation:
(+)
Number of Exons:
18
Description :
Structural maintenance of chromosomes protein 5
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1091
*** None ***
PositionContextScore
303EVERTKR|QL0.615
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4894 bases(100 bases per row)
ATGACGATGGCACCTGCGCGCACGGACGTGACGAGCGACTCGTCCTGCGAGGAGTACGTGAACGGCTCCATCTTCCGCGTCAAGCTGCACAACTTCCTCA
CGTACACGGACGCCGAGTTCCACCCGGGCCCACGCCTCAACCTCATCCTCGGACCGAACGGCACGGGCAAGAGCTCCATCGTCTGCGCGCTCTGCGTCGG
GCTCGCTGGCAGCACTAAGGTATGAACAGCACATAGTATTATCTCTGCTTCTTGCTCGTAATGCCTGGTATATGCATGCGTGTAATCTACTTGGCTATGT
TGCTGATGTGGCTCGTCTGATGTATGCGGATGTACTCACTGTTTTGCTGTGCTTGATTGTATGCAGCTGCTTGGTCGCGCTGACAAAGTCGGGCAGTTTG
TGCGCCATGAGAAAGAATCGGGATACACAGAGGTGCGTGTGTTGCTCTTATATTCGTTATATGCGCGTGTGTACCGTAAGCTAACGTATGTGTGCATGCA
CTGCACGGCGTCGTGTACCTCTAGATCGAGTTGTATTTCAAGAACGGCAACAAGGTGATCCGGCGCAACATCTACCGCGACAACAAGAGCTCGTGGATGC
TCAACGGGCGCGACTCGACGCTCAAGGCGGTTACAGGCGTGATGGAGGCGGCGAAGATCCAGATCGACAACCTCTGCCAGTTCCTACCGCAGGACAAAGT
GGGTGAGTTCTCACGCATGAACCCCGTGCAGCTGCTCAAGGCCACGGAGACGGCGATCATGGACGGCGACCTGGCGATCACGCACGACAAGATCATTGAG
CTGCAGAGCGATATGTCTGACAAGGAGCGCGTACGTTTTGCCTGTGCTTCTTGCCTTGCAGTGCGCTTCATGCGCCGACTATGATGGTAGTAACTAACTG
ACACTGATGATAATATTGATTGTCTTAGGAACTGGATGGCGCGCGCTCGTCGCTGGAGCTCAAGAAGAGTGAGAACCGTCAGCGTGAAAAGGAAGTCGAG
CGCATTCTCGACCACGAGATCCGCATTAAGGAGGTACTGCGAATTGCTATTACTGCTAACGTTCCTGTTGGACTGTTGGTGTTGGAAATGTTGGGAATGA
ATGAATCTAATGGTTGTGTGTTTGCTGGGCTCGTATAGACGGATTTGATGGAGAAGAAGTGCCTCTGGCTTGAGTTTGAGGAGATGAAACGCGAAGTTGA
AGAGCTCAAAGGAGAGAAAAAGCGCTGCCGCGAAGAAATGGATGTGCGTGCTTGCAAAAAGCAGGAGTAAACTCACCTGAGTTTTCATTCTTGTGCTATT
GCTAAAGCCTCATTGATGATGGGTGTGTGATGTCTGTTGCAGAAAGCGAAAGACGAGACCATCGCGCCACTAGGAGACCTTTTGGAGAAAGAAACCATCA
AGCTGGAGAAAGCCAAAGCAGAGTGCGTCCGCTTGCTAGTTGAAATCGTTGCGAGCCATTTCGAGCAATGTGATTGGCGTTATAATGGATTTGGTGTTTT
TACTGGATGACCCACAGGAAAACCGAGGTGGAGCGGACGAAGAGACAGCTGGAAGAGAAGCTCAAGCGCGAGAAGCAAAGCGTACGTTGCTGTTGCTGTT
GTCTTTGTGCCACAATGTGCACGTATTGAACTTTTGAGTGAACTGGCTGACCGAAATCTTTCCTGTGTTTTTGAATGTGCAGGTGGAAGCGCTGGAGAAT
TCGCAAAGCAAGACGCTCTCGGAAGTCAGTGAGCTGCGCAACCAGCACAACCTCTCGAAGCGCAAGCTCGAGCGACTTGAAACAGACCTCGCGGAAGTAA
GTACCCCTCTCTGCCACTGTGCACGCATAGAAACATAGCTTGGTTGGTGTCTAATAAGATAACGTTGCTCTCTTTTGCATGTTACTGGGTATAGTGGAAG
AAAGAGCGCGAAGAAATGCCAGCCGAAGCCTCGTTGAAAGAGCAGAAGGTAGAGCTGGAAAGAGCTCAACGAGCGAAAGAAATGGAGGTACGTCTTGTAA
TGGGCGTAATTTGATATTGTGCTATTCAGACATCCAACCGCATTGTTTTCGTTTGTATAGCACGCTGAGATCAGCAGCAAGCGAGAAGGTCGTGCACGCG
AACTGGCCGCTACGGAAGACGAGATCCGCAAAGTCAAGTACAAGCTCTCGAAGCTCGAAGACGAGGACGTGCAGCGCCGCCTCGCGCTCCAGAAAGTGGA
CCCAGACTCGATTCGTGCCGCAGACTGGGTGAAGCGCAACCAGCACAAGCTCAAGCGCAAGGTGTGGGGTCCGGTCGTGCTGGAAATGCAAGTCAACGAA
GCGCTGCACGCAAAGTACCTAGAAGACACACTCCCCAAGTGGCTCATGGCGGCTCTCGTGACCGAGTGCTACGAGGACTACAACACGATCATCCGAGAGC
TTAACAGTGAGAGCTCGGGACAGCGCATCAAGGCGTCGATCCTGATCGTTCAAGATGGGAAGTGCAACCCCGTGAGCCGCCCGTTCACTGACGACCAGCT
TGACATGTACCGTCGCGAGTTTGGCATCTCTGGGTTCCTTGATGAGGTGAGTCAGTAAAGAGAGCCTTTGGGCGCCTAGGTGCCTTTGTAAGGCTAGCAA
TGTATATTGTGGTATCCAAACTAACTGTGTGCGTGTTACGTAGTTGGTCAACGCTCCAGACGTTATCCACGAGGTCCTGCGAGCCCACGGCGGCATCCAC
ACGGTGCTTGTCGGCACCCGCCAGACTGAGGAGATTATCAACCAAGGCGGTGACATTTTCAACGCGATTGCGGCACCAGAGAGGAAAGCGGCGTTTGTGA
CGCCGTTCAAGAAATACGTGACATCTGGTGCGTTGGTGTGATTTGTTTGGGTTCTCTTGATTACTACAACTTCGAAGCAACTAATTACACATGCATGCAA
CAGTGTCCAAGTACGGGGAGAGAAACGTCACCACGCGCACGAACGATCTTCAGAACCCTCGCCTGCTCGCGGCGTCGTCTTCGAATGAGGACGAGAAGCA
CCAGATGAAGACCGTGCTGGACGAGTACACATCCAAGCTCTCTGGGATCCAAGATGAGGTAGGCACATCATGCTTGTTATGTGACCAATGTTGTGTGACG
GTCTATTGGTGAAGCTAAAGTGGAACCTTGTGTATCTTTTATACAATTACTGTAGATCAATGCGCTGAAATCACAAGAGCGTGCGTTTGCGGAAGAGCGC
AACAAGTCATCCCACCAGATCACGGAGATTCGGTCGCAGCTCAAGAAGATGATGCGCATGGACGAGAAGATCGCAGAGTCCGAGAACAAGGTCTACAGTC
TGCGGAGCGAACTTGCGAGGGTACGTGGCTGCTATTGTTGTTTGTGATTTCTCTGTGCTGAGTACTAACTGCTTTTGGTGGATCCAACCTGCTTGGCATT
TGCAGGATCTGTCCGAGAAAGAAGAGGCGATGATCCGAAAACTCAAGGGTCAAGCTGCAAAGTGAGATCATGCTTTGGTCGTATGACAGGTTGATGAACG
CATTGAAATTGACGTATCTCTTTTGTGTATGTGACCACTTTCAGACAAGCGCGGCACATCAAGGAGTGTCTCAAAATGACGAAAGAGCTGCTCATCGCGA
GTGCTCGAGACGCATCGCTCGCTCTGCGGGTCGGTGCCCAGCAAGTGCGCGCCGAGTTCACGGCCAAGCAGCTCAAGCGCGCGGAGCAGAAGATCAGGTT
TGTATCCATTTCCTCCCAGCAATGACTGGAGTGCTCCTCGCCCACGATAGAGTCTCGCCTCTTTTTTTGTTGTGTATATAAACAGAGAGCTCCAAGATGT
GTACAAGCGCGCGAAAGACAATCTCATGTCGATCGCGAAGAAGGCGATGCAGCTGAAGCGCCAGGCCGAGGAAGAAGCGCCGTGGGACGAGTACGAAGAA
GCATTCGCCAAGCTCTCGGACGACCTCGAAGACCTGCGTGGCTGCATTGAGAACAACCGCGCATCGCTCGACTGTTTCCGAGGCGACATCAGCGTCCGCG
AGATTTACCAGCGCGTCGCGGCGGAGATCGATCGCGAAGAGGCCGATCTGCAAGAGCTCGAGAACTTTGTCAACAACGGAGAGGACAAGGTCAACGCCAT
CAAGGTCAGTGGCTAGTAGTCCTGCTTACCACGTCTCATTGGTTGCTTCGACTATTATGGCTAACTGTGTGACGCTGACTGTGGTTGTGTTTGTTGTCCG
TTGTAGGAATCGTGGCACGCCAAGCTCAAGGACGTGGTGACGCAGATCGACTCGTCGTTCAAGGAGTTCTTCAAGGACATTGGCTGCGTGGGCGAGATCG
TGCTAGACGACGAGGATCAGGACATCTCCAAGTGGGGCATCCAGCGCCGCGCGCAGTTCCGCAAGAACACGAAGCTCTCGACGATGACTGCGGAGGAGCA
ATCCGGCGGTGTACGTGGCGTATGCCTTTTTCCATTATGATAAAGACCCGGAGTCTAACTGATGTCTACGCGCTTTGTTTGCTACCTTGTAGGAGAAATC
GGTGGGCACAATCATGTATTTAATGGCGCTGCAGAGCCTGACCAAGTGCCCATTCCGCGTCGTGGACGAGATCAACCAGGGCATGGACGTGTACAACGAG
CGCAAGGTATTCCAGCGGATCACCAAGTCGTCCTGCGGCAGCAAGCTCCCGCAGTACTTCCTCATCACGCCCAAGCTCATCACAGGCCTCCAGTACCACC
GCGACACGAAGGTCATGGTGATCCTCAACGGGCCGTGGAACAAGATCAAGCAGGAGTATTGGGACACAAAGAGGTTCGTCACCTGCGGCCACCAGCTCAA
ACGTGGCGGTGGCGGATCGAACGACATGCCGTCTCCAGCTGTGGCGCTGCCTCCAAAGAAGCGATCGCGCGTGAAGACCGAGATTGTGGGCTAA