Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-0.58
Orientation:
(-)
Number of Exons:
3
Description :
Brefeldin A-inhibited guanine nucleotide-exchange protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Sec7 domain33.65PS50190
Pleckstrin homology domain10.373PS50003
HmmSmart predictionP-Valprediction_id
Sec7 domain6SM00222
Pleckstrin homology domain2.1SM00233
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pleckstrin homology domainIPR001849
*** None ***
InsideOutsideTMhelix
1-1192
*** None ***
PositionContextScore
1133LMRRSAR|MS0.502
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3735 bases(100 bases per row)
ATGTATTCTGTGTTGATAGCCGAGAAAGAGTTTACCTGGAAAGAAGCTCAAGAGTACTATCTATATCCGCTCCTGTTAGCTTGTTACACTCGGCATGGTG
CTGCAGCTGAGGCGGCTTTGCAAGGAATCTCGCAATGTTTAGACGCGGGAATATTTGACGACACAGCTGTACTCTCCGATTTCTGTCGCTTGGAGGTGGC
TGTTGACGCAGTTACTTCGATATGCCATCAAGGCGTGAAGTCTCGATTCGCGCTGGCACTGCCGTTTTTCCGAAAGGTGAGTAACTTGTCCACCCAAAAA
GCAATACAGTGAGTCAGCAGGATATTGACAACAAAGTGTAACTTGTGAACTCTTTCAGGTCATTCGAAAGTGCCCAAATGGGTTCAACCCAGCCATCCTT
CATGCGATCCTGAAATCCGTCATCTTCATCGGCGATTTTGACTCGGCGTTGGTGAAATCCGTGGAAGACGAGCTTGTGGCGAAAATTATGAGTCGATACG
AGACCGAGCGCTGTGAGAAAGCGAAAATGATGATGGCTAGCCTCACTCATCCGATCAACACCGCGATCTCAACAGAGAGTATCGCTCGAGATTTTGTCGT
GCATCTCATCGACGATGTCAGCTCGGGCGTTGAGATTGCAAAAACCACGGAAAAGATGCTTGGAATCTTCAAAGTAAGTTTGTTGCCTTTCTTTTTCATG
CGCGATGATCCGAAGTTGATACTGAGCACAATCATGCTTGCGCCGCAGAGTCACTCGTCCATTCATTCACCAACATTTTGCTCAGATCTTGCGTCAGTCA
TGGATGATTTTATCGAAACCAACGTAAGCATTGCGCTAGTTTTCATTTCTGTTTGCGCTCCGTCGATTGTTCTAACACTAAGGCTCCTGTGTACTTTTAG
ACAGAAAAAAATGCGCTTCAGCTCGTGATCACTTTGAGCAAAGCGGTACATCGAAAAGCTATGAGTGCCAGCGACCACAGTTCCGAGCGAGACCAATTGT
CAATCATCAACTCTCTTCGCGCGCTCAACGTCGCGCTTTTGGGGGCTGGAATATTTACCAAGGAGCACCGCATTTTCGGTCAAATCATCCGGCGCTTTGT
GTTCGCGACAGTCAACTCCATCATCCTGATCTGGTCCACAGATGTGTTCCGCGCCAGTCTGACTCTAGTGTCAACTCTGTGGAACCACTATCGACGGCAC
CTGAAAGTTGAGCTCGCGTTACTATTTGAGCACCTTTTCCTGAGGATTCTTCGCAGCAACGCGGTGTGTGCTGCTGATCATCAGATGGACATCATGCATG
AACTCACGCCATGGATCCAGCTACCGCATAACGTCGTCGAGATTTTCCTCAACTTCGACATGGATCGCGTCCAGCAATGGAAGATCTTTGAGTACTTTTG
CTCATCACTATGCAATATCGCCGAGGGTAACACGTACCACACTAGTATCGCTGAAGCCCCTAATGATTCATCGTTGGATTTGCAAGTCCAAGCGATCAAC
ACAATCCTGGCGATTGCGCGAAGCGTGCTAGATGCGAGTGGACACGCTCACTTGATTAGTAGAGACGCTCGAACACGCCATCTCTCAATGGACAACGGCG
GCTGGGAGCAAGATGAATCAAACGACGAAGGTGCTTCCACTATGGCTACAGTCTGGAGGGTTCCAAATGCAGAAGTGGCTTCCATCGAAAGCTCGAGCAG
TGCATTGAGTCAACCCAGCTCTCCTGTGATCAGCAGCACGAAAGGAAGTTGTAGTGAACAGTCCAATATCGGGAGCACACGAAGTTCAAAGTTCGGGAGT
ATGTCGGTGCGCATGCGCAATGAACTTCAAAAGCGTAACCAGCAACTTCTGAAACGAGCTATGGAGATTGCGTCGTCAAAGAGCCTGAAAAAGGCGATCG
AGTACCTCGTCGCAATGAATTTTGTGAAGGAATCACCCCGGGACGTCACATCCTTTCTACGAATTTACCACGACTTCTTCGATGAAGCCGAGATCGGGGA
TTATTTGGGAGAGGGAGACGAGGATTTTAAAGTCCAAGTTCGGCTCTCGTACGTGCGAGCGATTTCGTTCAAGGGTATGACACTCGTCGAGTCTCTTCGG
CATTTTCTCACAAACGGAGGCTTCCGACTGCCGGGAGAAGCTCAGAAAATCGAGCGCATGGTCGAAGCGTTCGCGCACTGCTACTGGGAAGATTCGCCGG
CTTCTTTCTCGTCAGCAGACACAGCGATGATCATCGCATACTCGATCATCATGCTCAACACAGACTTGCACAACCCACAAGTGAAGAAAAACAAGATGTC
AAAAGACCAGTTTGTGAAAAACAACCGCGGTATTGACAACGGTAAGGATTTGCCCAAGCGGTTTCTCGAAGAAATCTACGAAGACATTGCGCATCACCCG
ATGCACATCAAAGGCACCCGATTCCTTCCTCCTGCAAAGGCGCGCGAAGCGAACACGTCGCACTTGGACTTGGACAAAGACAAGTTTCGAGTTGGTCTCA
CGAAATCTGTCGCGCAATTCGAGGAGTTGCTCAAAGACTTGGGTCAGTCGTACTACACATTCAACTTTGTTGGTATCGACACGTGCATTAGTCCGGACTT
GATCAAGCTCTTGTTTGAACGCGTGTGGTTTCATCTACTAGCGCTTTCCACATCGATCCTCTGCGACAACCAGTCCGACCTGTCGATGACCATGCACTGC
CTCGATCTTCTTCGCTTCAGCATTTCTACGTGTCTGTTCCTTGACATGCCCGTCGAGCGACAAGCTTTCTGCATCTTATTGTTCAAAGTTCAAAGCGCAC
TGGAAGAAACCAATATCGGCGAAGTAGTCGATGATGGTGATCGTGACAGCAGTATCAGCGATGCCAGCGATGCGGTAGCAAAGGAGACGTCGCCGCTAGC
AAACGAGTCGCAGGTATGGAGGGAAAGCATCGAAGCTGCCACAGCGACAGATGATCCGTGGCGCGTGATGGGTGACATCCACTTGCTGGTCAACAAGATG
AAGGACGCGATCCAACGGCAGCAAAAGTTCGAGGAACTCAATTTTGTGATCAAGCGCATGAACCGCAGCCACGTGAGCCTGAAAGATGCGACGCATTTCA
TCCGCGAGGGGGATTTGATCAAAAAGTGCCGCTCGCGCAGCAAAGTGTACCGCTTCTTCCTGTTTAATGACCAGCTCATCTACGCGGACAAGAGTATGTC
CGGTCTCTGGAACCCGCACAACTCGCTGCGCTTGAAACTCACGCGCATCACAGACGTTCCTGACAGTGCCCTGCACAAGAACGCATTCCAGATCAACAAT
CCCATCAAGTCCTTCATCGTGTACGCCGACAGCGCAAACACGAAGGCCGAGTGGGTACACTTGATCGAGGAAGGAATTTCCGAGGCTGGGAAGAAGATGA
AGAACAACGCTCGCCGGGTGTCGACGCAGTCGTTTATTTCTGATGCCTCTGCTCCAGCTCAAGCCATGCCGATAGACGCATCTTCTGTTGGCTCTGGATC
CTCATCAGCGGCTTCTGTTGTGGACGCGATGAAAGGATTGATGCGCCGGAGCGCTCGCATGTCATCACCGACGAATGGAGCTGCTGTGCAGTCCTTTGAA
TTGCAATCTGAGGATCCGCAGGCCTCGTCGCCAAAGAATCAGCCTCCGCTATTACTAGCAGCAGACAATCCCCGGGAGCAAGGCTCATGCAAACCGAGCA
CAAATGGAGGACCCGACGCATCCCAAGAGCGATTG