Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-fgenesh-gene-1.6
Orientation:
(+)
Number of Exons:
1
Description :
Myosin
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Myosin head, motor domain1.2PR00193
Myosin head, motor domain1.2PR00193
Myosin head, motor domain1.2PR00193
Myosin head, motor domain1.2PR00193
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site8.846PS50096
IQ motif, EF-hand binding site9.45PS50096
IQ motif, EF-hand binding site6.98PS50096
Zinc finger, FYVE-related12.602PS50178
HmmSmart predictionP-Valprediction_id
Myosin head, motor domain1.3SM00242
IQ motif, EF-hand binding site0.0045SM00015
IQ motif, EF-hand binding site4SM00015
IQ motif, EF-hand binding site3.1SM00015
FYVE zinc finger4.4SM00064
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Zinc finger, FYVE-relatedIPR017455
*** None ***
InsideOutsideTMhelix
1-1556
*** None ***
PositionContextScore
1182ADKRSSR|SS0.513
1185RSSRSSR|NS0.539
1368SSSRRTR|SS0.728
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein bindingGO:0005515IEA
metal ion bindingGO:0046872IEA
motor activityGO:0003774IEA
myosin complexGO:0016459IEA
*** None ***
*** None ***
Sequence
        4671 bases(100 bases per row)
ATGGACATCGGCACGGAGGTGTGGGTGAAGAGCGAGAAGCAGGTGTGGGTGCCGGGCGTGGTGCTCGACTGCCAGGCCGTGGGCACCACGGGCGTCGTCA
AGGTCAAGCTCGACGACGGCGCGATCGTCACGAGCGTCTACGCAGAAGAGGACGATCCGGTGCGCGGGAATGAGCTCTATATCCGCAACAAGGAGCGCAG
CGTCGAGGACCTCGCGTGCCTCACGGGACTCGAGTACCTGCACGAGCCGGCGCTGCTGCACGCGCTCAGTGAACGCTTCTCGCACGATCATATTTATACG
TCGATCGGCGACATCCTCGTGGCCGTAAATCCGCTCAAGCCGCTCGACCTCTATTCGCAAGCCACGATTGATCAGTACAAGGACGCGATGTACCAGGAAG
GCGAGGTGTCTTCAGATCGCAGTCGAAGCAGTTCGACGACCGCAGCAGTTGGGAGTGCAGGAAACTCTACGCTTGCGGACGCACCGCCGCATGTGTTTGC
GATTGGCGCCAAGGCGTTCGGTGGATTGCTGAAGCAGGACCAGCGCAACCAGTCGATTCTAGTGAGCGGTGAGAGCGGATCAGGAAAGACCGAATCGACC
AAGTTCCTGATGCAGTTCCTCACCTCGGTCGGCAGTGACGCGTCTGCCAGCGAACACTCGGCGGGCGAGGTCGTGGAGATTGGACGACGGATTTTGCAGA
CGAACCCGATCCTCGAGTCTTTCGGAAACGCGCAGACGATCCGTAACGACAACAGTTCGCGCTTTGGTAAATTCATCAAGATCCAGTTCAGCCACAAAAA
TGACATCGTCGGCGCGGAGATCGCGTCATACCTTTTGGAGAAAGTCCGCCTGATTCATCAGTCCCCAGGCGAACGTAACTTCCACATTTTCTATGAGCTG
CTTGAAGGTGCCGATGAAGCTCAGCTGAGCGCGCTCGGTTTGAAGCGTGGCGCGAAATACGAGCTGCTGAATGCCTACGGTGGTCCGATGAATCGACGAT
CAGCCATTGGCGCGAACCAGTTTGCGCAGCGATTTGCACAAACGGTCCAGGCTTTTGAAGACACAGGGATTGACAGCGAGGAGCAGAACCTGATTTACCG
GATACTGGCCGCGCTGCTGCATTTGGGGAACGTGAATTTTATGATGGAGATCCACGAAGGAAAAGGTGAATCCGGCACGCGAGAGGAGTCAGCGGCAGTG
ACAGCAGCGACACGGTATCACTTTGAGAAATGCGCGGAGCTGCTTGGTGTAACGACGAAGGATCTTGACTCGTTGCTGCTGACCAGAAAGATCACGGCAG
GTTCTGAAGTGATGGTGTTGAAGCAGAACGCGGAGCAGGCAAAGGATATCTGTCGATCGTTGGCGAAGGCAATCTACGGACGCGTGTTTTCCTGGTTAGT
GCGGAGACTAAGTGACGGGATCAACTACTGCGACAACTCGGACGTGTACGACTACGACGCGCCTGAAATCAAGACCATCGGCATTCTCGATATCTTCGGT
TTCGAGAGCCTTGGTCGCAATGGCTTCGAGCAGCTTTGCATCAACTACGCGAATGAGAGATTACAAGCGCAGTTCAACGAATTCGTGTTCATCAAGGAGC
AGGACGTGTACGTTTCGGAAGGCATCGACTGGCGATCTATCCCATATCCCAGCAACGAAGCGTGTCTGTCGCTCTTTGACGACAAGTCGAACGGTCTGTT
TTCGCTGCTCGACCAAGAATGTTTGATGCCAAAAGGATCGGATGAAGCGCTAGGGACGAAGTTCTACCGGTACCACGGAGGAACCGAAGGTGTCAGTGGA
GGGAGCTTGCTGAAACATCAGCAGAGTTTGCCGATGTACACGTTACCACAGATCATGACCTCGTTTGGCCGATACTTGCAGCAGCCCGCGGATCAAATTG
AGAAGGAGCCTGAGCCAGCACCAAGCGGAAAAGTGAAGCCGTTCTACGCGTCGAAGATGGACCGTGTCAAGCACCAGTTCGTCGTGCACCATTTCGCTGG
CAGGGTGTGCTATCGCATTGAGCAGTTTGTTGAGAAGAATCTGGACATGTTGCCTACTGAAGCCAGCACGGTGTTCTCTTCATCGTCGAATGCTATCGTG
ATTGCGATCGGGGATGTTGAGGTGTTGGATCAGGTATCTGAACGAGGGCCTGGCAGACGGCGTCACTCTTTGCTCCGAGCACCAAGTGTTTCTGCACAGT
TCAAGAGCCAGCTGGATCGACTTGTCGAAGAAATTGGTCTGACGGAAGCGCACTATGTTCGCTGTCTCAAGCCGAATGAGGTGAAGCGACCGGGAATCTT
TGATCGCGAGAGGATGGTGGAACAGCTGCGCTCCGTGGGTGTGCTGGAGGCGCTGCGCATTGCTCGTGCCGGCTATTCGGTTCGCCTTGGTCACTCGACT
TTCATCGAGTTGTTCTCCGGTTTCCGCTCGCTTGTCGGAGCTAGTGCTGGAAATGCGAGAAAGTTTCCACACTCGTATTGCAAAGCCTTGGTAGCTGGTT
TGCTCGTCGAAGTGCAACGCAAAGAAGGGAACGGAGAGGTGAAGGCAAAGACCACCAGCAGCATCTTCGACGCTGAAGAAAGCAACGCGGTTGAAGAAGC
TCGGCGGCATGGAGTTCAGGTCGGCAGGACGTTGGTGTTTTGCAAGACCGAAACTTTCAACAAGCTCTCTCGACTGCGCTTGGAACTTCGAGATCACTCT
GCAACTGTGCTGCAACGATACTACCGCGGCTATCGTCGGCGCCGTCGTTTCCAGCAACTCCGAGACTTTGTGTACCGCATCCAATCCATCATCCGAGGTT
TCATCGCGCGGAAGCAAGTGAAAGAGCTGAAGCGTGTGCGGCAAGAGAAAGCAGCAAACACCATTCAACGATGCTGGAGAGGAAAGCTGGTGCGCAACCA
GATTCTTGAAAAGAAGATCCGCTTGTTCCGCTTGCGAACGGCGTTCAAGCTCTTCCAATTTGCCCACACTCGACTCAAAGAGTACGTCAGTGATGCGGAG
GAGCCTCAACTTCCTGACATTATTCCGATCGTGTCATCAAGAATTGGTTTGGACAAAGTGGCCAAAGACAAAGATGCTACAACGGATGTTCAATCATGGG
CGAGCTTGCAGGGAGGATCAGACAGCGACGACTACGCTGTGAAAGCGTCCAGCAAGAAGAAGTCGCTCAAGCGAAGTGAGAAGCAGCGAATTCGATCTGA
CGTGGAATCAGAGAGCGAATCAGACGAAGCTCCTCGAAAGAGTAAGAAAGCGTCTTCTCGGACCTCCAAGCGAAGCGAGAAGCAGCGAATTCGATCTGAC
GTGGAATCGGAATCGGAATCGGAAAGTGAGTCCACTTCGGATGAAGCTCCTCGTCGGAAATCTTCTTCCCGAACTGACAACCACTACTCGCAGTCAAAGC
GAAAGTCGTCGAAGAAGAAGAAGCGAAAAGATGCCGATGAAGATCGAAACTTCAAGTTGGAGAACGAGATCTTGCGTCTAAAGCAAATGCTAGTAGAGAA
ACATAACAGCCGTGACTCGTCCCGAGCTGACAAGCGCTCTTCTCGGTCTTCGCGCAACTCGAGGTTTGGCATCCAAGATATGTACCCAGATCCGATGGAC
ATGCAAACTCGAGCGAGTCGCAGAAGTTTATCCATGGACGAGATCGATTTTTCAGCTGATGAGGCTGAGGATGGTGACGAAGTCTCGCTCTTGCCGCCAC
GCCGCGCGCAGAGTGTGTACCACACTCGCCAGCTGGACCAGGTATCGATGCTGTCGCAGAAAATCGAAGAGCTGGACTCGAAGTGCAAGTTCTTGGAGCA
ACTCGTTGCGAGAAAGTCATTTGACGAATCGTCGCGATCCTCGATTGCGTACAGCCAACGATCGTCAGGCAGTGGTGGGTGGGACCGTCGACGGTATCCA
TCTGTGATCGATACAGGGAGCGTCTACGGAGATGGTCAGTTCAGCGAGCGTGACCACGGTCCTAACGGCGACATGGACGGCATGATCCGAAACATTCAGC
AGCAGATGGACATGCTTCGTCAGACTATGGTGCAGAAGGAAGAGGCGATCCAGAGCCGTCGCGAAGCGCACCCAACGTCGTTTTCAAGCTCTCGCCGCAC
ACGATCGTCCTCTGCTGCATCCTCTGGATCGTTTTCGGGGATGCTGGGTGACCCCATGCATTACAACAATAGTCTCCTGTCGCCAGCTGAATCGCATCGC
AAGCAGCCATCATCTGCAGGAAGCGGAACGTACAGCGCTGGCTCGGTTGGATTTCCGCCAACTCCAACATCGTCGATGCTTCCAGGCCAACCTCGCTCGA
TTCCAATTCGAATGAACAGTATGAGCAGCATGGGCAGCAATGGTGGCGGTCGCCATGTGCCTCGCATCGTCAAGTGGGCGAGAAGCAACAATTGCTTCGA
GTGCGAAGAGCCGTTCAACATATTTGTGCGTCGCCACCACTGCCGCATGTGCGGCAATTCGTTCTGCCACGAGCACTCAAGCCGCCGGGTGACGCTGTTC
GGTATCGGTTTTGACGACGAACCTGTGCGCGTGTGCGACGCTTGCTTCGCTGATCACTACGCGTTCTCGCAGGATCCGTACTCCACGGTGGCTGCGCCGT
ATCCGGCGTTCCCGAGCTACAGTGGCGGATCAATGTCGGCACTCGCATCCTCGCACGCCAGTGCTGTCTGA