Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-0.42
Orientation:
(+)
Number of Exons:
1
Description :
F-box/WD-repeat protein 1A
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Fibronectin, type III12.265PS50853
Fibronectin, type III11.906PS50853
WD40-repeat-containing domain23.783PS50294
WD40 repeat12.547PS50082
WD40 repeat11.511PS50082
HmmSmart predictionP-Valprediction_id
Fibronectin, type III0.023SM00060
Fibronectin, type III0.12SM00060
WD40 repeat71SM00320
WD40 repeat53SM00320
WD40 repeat3.6SM00320
WD40 repeat1.2SM00320
WD40 repeat0.069SM00320
WD40 repeat2.6SM00320
LysM domain6.3SM00257
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1793
*** None ***
*** None ***
TypeScore
nuclear478
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
cell wall macromolecule catabolic processGO:0016998IEA
*** None ***
*** None ***
Sequence
        5382 bases(100 bases per row)
ATGAAGAGCGAGACGTCAAGTGTGGACGCGTATACTGGTGCGAGTACTGTATCTGCTGAATGGCGTGCCGGCGAACTCAAGAGACGCGTGGAGAACCGTA
GGCTCGCAGCACGGTCACTTTTGTCTTGCAGCGATGGGAGCGTATGGCCGCCTTCTTCAGCTTCAGCGCCATCAACTCTCTCGTCTGCCTCGTCGTCACT
GTTATCGTCTAAATTTTCTTCTAACTCGCTCAAGACATCAGTGTCGACGCCGGTGACGTCCCTATCCTCGCCGCTGGAAATGCCATTAACGATATCGATT
CCGGTCTCGCTCACGCGATCGAAAGACAAGCAGCAACAACAACGCAAACCACAAAGCTATTTCGCGAATGGGTCGACACAACCGTTTTCATCGTTCATAT
CACTTCCTCAGCTCTGGAATACCAAGCAGGAGGTCCTGGGTGTACACTTGGATGTGGTGGACATGCAAGCGAAGCAGGCGGCGTCACTCCACATGTGCGG
CCAGCAGTTCCAAGTCGAGAAGAATGTGCGGCAGCTCAAGTCGGGCATCTCAGCCGCGCAGCTTTCGATTCGACAGAAGCAGGACGATCTGGATGCACTA
CAGAATCGAGTGCTACGACTCTCCAAGACATTACATGACTCGTCTGGCGAGAAGAACTTTGCAAAGAACAAGTTGGCGCAACTTGACGAGATCAGGGAGC
TGCGCAGTGGCGTGAAGCGATGTAAAGTGTGCGCGAAAGAACTTTTGCCACACGTGCTTGTGATCCACGAAGCAAGCTGCAGTATTGGCACCAACAAACT
TGTTGGAGTGTCGCAGCCACACCTCGATGAGCCGATGAGGAATTTGAACCAGTTCACTGACCAAGTGCGCGAGATCAGGAGGGACGACAGTTTTGCTGGT
ACTCTGGCACCGAAGCAGCGCACACTCCCTTGCTTTCTATCCCAGCCGCCTCGAAACCTGCGTGTCGCGCTTGACAATTCGGTCAGTGTTACACACAGCT
CCATTCTTCTAGAGTGGGATCCTCCGATTTTCACAGGCTCCACCCCGATCATTGACTACGAAGTGCATTTTTCGCTCTGTCAAACAGTGACAAAGCGACT
GAAAGGCACTGATCCGCGAGCAACCATTGGTCGTGAATTCCAAGCGTTTCCGCCGCAGACCACTTCACGGTGGTGTCTCCAAATTCCCGTTGCTCAGAAC
CAGTACTGGCTGCACGATCTGGTCGCGGACCAGGAATACGGCGAATTTGCGGTCCGTGCGATCACGAAGAACGGCAAGAGCGAGCTGAGCAACAGAGTCG
AGCTCGTGAAAACTGCGCCAGCTGTACCGCCCACCAAGCCCTATTTCCTGTGCACAGGCATAATCACAGCGAAGACCATCTCTCTGGGCTGGCAAGAGCC
GCTGGATGATGGTGGCTCTGCGATTGAGTTCTACGAGATCGTGTTCAGCGAAGTGGTCATGCAAGAGACGATTGCTGATACAACTACGGACAAGAAGAAT
TTCCTGGATGTGTCGGAGGTGGTCTACAAGCCACGTCGCGTACGAACGACCTCGAACGCCACGACGTTCGTGATCACAGAACTGTTGAGTGGGAAAGAGC
ACAAGGATTTCCATGTCCGTGCAGTGAACCGTGCGGGCATTCCTGGTGAATTCAGCGAGGCAGTCGCGTCGATTTTCACGATCGCACCGGGAAATGAGTT
CAAACTGCTCGATGAGCTTCAGGCTGCTGTCAACTCGCGCGCGAAAATCGTCGATTCCCAATTTCTCAGTGGATTTATGCAGCGCTACGAGCGTAACCAC
TACATCCACTTGGTGTCGCGGTTTATTGTCTCGATGCATCCTGAGATGGAAACAAAAGTCAACAATATCCTGAACCGAACGGACATGAGTCTGTCCGATA
AAGAGGAAGATGATAGCAAAGATCAAGACAATGATGAAGCTGAGTGTCTATGGTCAGAGGCTTCCAAAAAAAAGCGATTTGATGAACTCTCAGAAGAAGA
GCTGGTCCAAGAGCGACGGCGTCAGTTCCACTTCCGCATCTCCGAGCTGAAAAACAGGCTCAAGAGCGCCGAGTACAATGTTCAGTGGAGCAAAGACCGT
CGCGTGGACCTTGTCGCGCTGATTCGTGCAGCTGAGAATCGAATTCTCGAAAAACAAGCGGAGCTTGAGCGCGCAAAGATGTTCACTGGCCCGCAAATGG
ACTCGGATGTCTTGGAGAATGGACTGCAACGGTTCTACACAAAGGACCTGATCTTTGCACTGGAAGACGAAATTGATATTGAGCAGCTCTACATTGTCGA
CGCGAAAAGCGAGATCGTTCAAGTGGAGAATTACCTCCGTGCCGATGAGAAGAAGCGTGATTTGCTCTTGCGACGATTGCAGGATCGTAAAGACGCGCTC
GTGAGTTTTGAGATGAATCCCAGAGGTAGTCCTGACGATTCGAGCAGCCACCACCAAGCAGGCGTCAAGGTGGCAAGTCTCGCACGACTCCAAAAAGGCG
AATTGTATCGTGCTTTCTCTGCGTTTGTGATAAACCGCACTGCTGCGATCGAAAATCGCAACAAAGTGCGAGCCACTTTGACGCGCTTTCTGAACTATCG
ATGTCGAGTCGCGTTCAACCACTGGTTGTGGCTTGTGCGAAACGTCTTACGCCAGTCCAGCAGTTGCAGTAGTGGCGGTGACGCGTTTGGAGTTGGGAGT
ATCGGACTCGTGAACGCTGCGCTCGATCGTGACGACTTAATGCTTCAGAGCCAAGAGCTCCTCCAGGAACTCCGCACAACAAACGGCAGTCTCAAGAATC
TAGTGTGGACAAAAGAGCAACAAACTGAGCAGCAACGCTTGCAGGTCTCGAACAACATCGACGGTGACAAAAAGCACGTTTTCGAGCGAGAAAAGTACTA
CCCGCTTATGCTCGAAGCCGATGCGAAAATGGACATTGAAGACTACGAAGGCGCTCAAAGACTGTACGATCTCATCCTCAACAACACGGATTGGATGGAC
AAAATGCCGCACGTACAGATTTTGCAGTTGCAGCTCAAGCTTGGGAATGTCAGTTTCCACTTGAAAAACTATGAGCAAGCGCTCATTTTTCTGAATCGCG
CCTCGTTTCTCGCAGTGCGACTCGGGCTTCGCGCAGACGAAGGCGCGATTGGCTTACTCGCTGCTGAGGTTCATTTCGCGCTTCGCTCGCTTCGCCTCAG
TATCGAGAACTACGAACACGCGCTGCTTTGTTTTGAAGCTGCCGGTGATAAAAAGGGGCAAGTGGCGTGCTTTCGGGGCTTGCAGTGCGTGTACACAAAG
TTCGATGACAAGGAAATGGTGCAGCTCAACAAAGAACAAGCGGACGAGATCGAGTTTGTGCTGTCGAACAAACTCACAAGCGCCGGCCAAGTGCTCGACA
ACCTGCAGAAAAGGCTCGTCGGGGTTGGAGCTGAATCGTCGACTGAGATCACTTTGGAGCGTGTCGGCGCGATCGTTCCGAGGCTCCGCGCACAGCGCAT
CCAGCGCAAGCTCGACATCAGTGAAGAAGTAAAACTCGTTTCGAGTCTTGAGAAGATTCTCGCTGAAAAAAACACGCTGCTGGTGCAAGGTGAAGCCGAC
TTAAAGCGCGCACTCGCTAGTGACACACCACAAGTGGATTCGAGTGTGCTCAGCGGCACGAATGCGCGATATGAAATCGAGGATTTCAAAAAAAAGCTCG
GGAAGCTGATGGGCAGCGTCAAAGCTGGCGAGGAGAACATTTTAAAGGAAATTGCAAACGCCAACATTCGTATCCGCAACAGTGAGGACGAGATCAACGA
GCTGGAACAGGAGCTGGGCGTGGAAACGGGCAATCTAATGCGCCAAATGATGGGAAAAGATAAGCTGCGGTGCTTTTGTTTTAGCGCCAAGAACGAAGCG
CTGAAGTGTGTCGTTGGTACTGCGAGCCACGGCGTCACCACGTGCGTCGCAACGTCGGAGCTCACTGGTATTCTCTTTGATCTACTTACTGGCGCGTGTC
TGGGCCAGGCTGTAGGAGATCCGCTCCGACAGCACTTGGGCCCGCCTCGAGGTCACCAGGCACAAATCGTAGCGCTCTATTACGTCGGTAATCGCATTTA
CACTGGTGGCATGGATGCTGCACTTGGCGTTTGGGAAGTGCAGGAGGATGGCGGAGGCTCTGCAGTCGTCGTGGCGCTGGTCAAGATGGTGCAGGAGTTT
GACGCGGCAGTGGTCAGCATCGTTGCAGACAACCAATTGATTGTCTGTGGGTGCTCGGACTGCGACCTGTTTGTTTTCGATGCAAGTTCGCTTGCACTTG
TCACGCGTGTGATCGCCGCACACGATCGGAGCGTCATGGCAGTCGCAGTAAATTCTACCAGAAACTGGTTCACGACAGGTGGTGCAGACAACCGCGTCAA
AGTTTGGGAGCTTGGAGTTGTTTCTCAGCACACTATGTATCGCAAAGTCACACTGCGGTACTGCCTGGAGCCTGAGCGGCGTGGCGATGAGTTCTTTAAC
GGGCATTTGCATCCAGTGACGTGCTTGAAACAGGTCTCGAGCGAGATAGTGAGTGGCGACAGCAACGGTCGCATCATCATCTGGAACCTCGATGCCGGCG
CTGGAGACAAAGACAGCAAGTTGTTGCGCATCTGCGACGTCCACCGAAATGTGCCAGTAATGTGTCTTCAATTTGACGCGACGCGGATCGTGAGCGGCGC
ACAGGATGGTAACATTTGCGTGACGGACTTCGCCACAGGCCATCTCATCCAGACGCTCCATGGTCACAGAGCGAGCGTCCTGGATCTGCAGTTTGATCCC
AAGAGACTCATGAGCATGTCTGCGGACGGCAAAGTGCGATTGTGGTACTGGCAAAGTCGGATCGGTGTCAGTGCTGCAGTGGACCGCAAGAAGTACCACA
TCCTGGGCTCAGGGGAGACGCTCAAGGCGCTCTCGCTCAAGTATCGCACGAGTATTAACCAGTTGCTCAAGTGGAATGGTCTGCCAGACTCGAGCAAGCT
GTATCTCGGCCAGAAACTCGTGGTGGACATCGATGCGAACAATAGTGTGGCGACAGACGAACTCAAGATACTCGACATGGCGGTCTCGACAACATTCGGG
AAAGTGTCGCACGAGAATCTGGCATTCGTCGCAGCAAACAAGGCGAAGAGCACGAACGTGGAGACTCAGTGGGCGTCGCGCAAGCTCGCCATGCTCGCCA
AGGAGTACTTCCCACCTCTGGACGACGAGAATGAGAAGCACAAAGGAGATAAAGCTCAGGATGAGCAAGAAGAAGTGGACTCGGACTCGGATGACTCGGA
CATGCCCATTGACGAGACCTCTTCTGTGGCTGGCGAACAAGAAGAAAATCACGAAGAAGCAAAAGAAGAAAAATCCAAGTGA