Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-1.30
Orientation:
(+)
Number of Exons:
1
Description :
Gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-159
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        480 bases(100 bases per row)
ATGTACGGGTTCGCGTCCACGACGTCTTCGTGGCTCGCTACGTACGCGCCCATCGACGCAATCAGCACCGAGAACGCGCCAACGTCCACCTGCAGCAACG
TCTCAAACGCCAGGTGGAGCGCGTTCGGGAACACGTGCGTCTTCACAAAGTCCACCTCGATGCTTGTGTGTGAGAAGATCTGTTCCGAGAGCTGCATCAG
GCGCGTTCGCCAGTACGTCTTGATCTCTTCCGAGCCGGAGCTCTTCGCGTCATCAGCAGCGCAGAAGATCGCCTTCACCTGGGCGGCAACAATGTTGGAT
TTGTCTGGGAAGATGCGCCAGACCCCTTCAAAGAGCGGTACGATCTCGTCGCGAAGCGGTTCATTGCACGTCGAGAGGATGGTGGACTCAGTCGGATCAT
CCGACGGCAGCAGCTTTGCGCACACGCTCTGCACGGTCGTGATCTGTTTCTCCTGCGCAACGAGACGGCCGCCGCGGTAG