Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-1.45
Orientation:
(-)
Number of Exons:
3
Description :
DNA mismatch repair protein Msh2
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
DNA mismatch repair protein MutS, core7.4SM00533
DNA mismatch repair protein MutS, C-terminal8.4SM00534
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-754
NN-scoreoddsWeighted Score
0.5891.4120.003
*** None ***
TypeScore
cytoplasmic304
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
mismatch repairGO:0006298IEA
KO ID
K08735
K08735
K08735
*** None ***
Sequence
        2512 bases(100 bases per row)
ATGGGTGACATGGATGACGCGCCGCAACCGGAGATCGCGATTCAGATCAAGAACAGCAAGCACCTCAAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CGTGCGCCGCCCGCGCCTGCGCCGCTCCTGCGTGAAAGGGCAGGCGGACGAAGACACCAAGCACTGGGAGTTCGTGCTCTACGCGTTCTCGGACTCGAGC
GAGCTCACGAACCTCGAGACGCTGCTCGTGCAGATCGTGCCGTCGCGATGCTACTTGCCCGCCGATCTTGGACAGGAGCCGCATGTCGGTACGTCGAATG
TCTAAGCTTATGTGTGTGCGTGTGTGTGTGTGTCTATAGCTGATCTGTATGATTGGTACTAGTACATAGCCTAATCATGCTTTGTTTCATTCTATCTACA
GGCGACAAGAAGAAGTTACACTCGCTACTGAAGGCGCTAGATGTGGCGAATGTGTACATTAAGAAGAACTCGTTCAAAGTAACGAATCTCGAAGCGAACC
TGGGTCGGCTTCTCGGCGCGTCTTCGATGGCGTCGTACAAGAATGAGCTGGATATGGAGCTCGCCACCGGCTCACTCGCATGCCTGATTGACGCGCTAGA
GCTCATGTCGAACACCGACAACTTTGGGTGCTACACGCTCAGCGAGGGTAATTTGTCGTCTGCGATGCAGCTCGACAGCTCGGCGATCTGGTCGCTCAAT
TTGCTTCCTGACCCGACCGTGAAAGGCACAATCCGCCACGGTGGCAGCGTGCTGGAGATTTTGAACCGCGGCAAGACCACCATGGGGCGACGCTTGCTCG
AGCGTTGGATCCGCCAGCCACTCATCGACCTGAAGGATATTGAAGCGCGACAGAACGTCGTACAAGTGTTTGTGGACGACTCGTCGCTTCGCATGGAGCT
GCTGGACGAGTGCATGAAGTCACTGCCCGACCTCGAGCGTCTGAGCGTCGTGCTGGAGAAGAAGAGGAACGTGAAGATCCACGACCTCGTGACTGTGTAC
GACGCTGCGAAGGACGCGATCCCGAGGATCCTCGCTTTGCTGCGCAACTATGACGGCGCGTCGGCCTCGCTGATCGAAGAAAAGTACACTGCGCCATTGG
CGAAGATCGTCGAGGATATGAGCGGATACGTGGAGCTGATCGAGGAAGTGGTGGACCTGGACACGCGTCCCAACCTCGTGATCAACGCCAAGCACGACGA
GGACTTGCAGGCGCTGCGCAGTGAGTGGAACGACGTGCTCTCAGAGATCGAGGACGAGCACCGCAACGCGCGCGAGACCATCGGAGGCGACATCAAGTGC
GAGAAGGACAAGGTGCGCGAGTTCGTGTTCCGCATCGTCAACATGAAGGAAGAGGCGCGCATCTCCAAGCTGCCGTACGTGCACATCTGCCAAGTGCTGG
TGAACGGCGTCCAGTTCACGACCACGAAGCTCAAGTCACTCGCGACAGAGCACCGACGCATCAAAAATGAGTACGAGAAGCGCCAGGCGAACCTGCTCGA
CGCTGCGAGCGATGTTGCGACCACGTACGTGCCCGTGTTGGAAGCCGCGACCGCGACGCTCGCGGAGCTGGACGTGCTGCTCGGATTTGCGCACGCGGCG
TGCCACGCGGGCTCGGGCTACTGTCGCCCGCAGCTCGAGGAGAACGGCGAGTGCGTCGTGCTCACGTCGTCTCGTCACCCGTGCGTGGAGCTCCAGGACC
AAGTGGACTTCATCCCAAACGACTATCACCTCGTCCGCGACCAATCGCGCTTCCAACTCATCACAGGACCCAACATGGGCGGCAAGAGCACGTACATCCG
GCAGCTCGGGACGATCGTGGTCATGGCGCAGATCGGCAGCTTCGTGCCTGCCGAGGTCGCGCGGCTGCCCGTGTTCGACAAGCTGCTCGTGCGCGTCGGC
GCAGGTGACTTGCAGCAGCGCGGCGTGTCGACATTCATGATGGAGATGCTGGAGGCGTCGGCGATCCTGCACAAGGCGACGAACAAGTCGCTCGTGATCA
TCGACGAGCTCGGCCGCGGCACGTCCACGTACGACGGTTTTGGGCTCGCGTGGGCGATCTCCGAGTACCTGCTGGACAAGGTCGGCGCGATGTGTCTCTT
CGCGACGCACTTCCACGAGCTCACGGCGCTACAGCAGGAGTACCCGCGGGGCTTTGCGAACAAGCACGTGACTGCGGTCGCGGGCGACAAGCAGATCACG
ATGGTCTACCAGGTGCGCGACGGCGCCTGCATGGAGAGTTTCGGCGTGCACGTGGCGGCCATGGCGGGCTTCCCGGCGGCCGTGGTCGCGTGCGCCAAGC
GCAAGAGCGAGGAGCTCGAGAGCTTCGCTTCAAGCTCCAGCTCCAGCAAGCACAAGCTCGAGCAAGTCAATGATGATGACAAACCTCCGCTTAAAAAGGC
CAGGGTTGCGTTTATGCACGCCTTTTCGGCGCTCCCATTAGCTGATCTGTCAGCGGACGAATCGGTGGCAGCGGTCCGGGCACTGCTCGTAGCCAATAGC
CTGGTACAATAA