Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-fgenesh-gene-1.19
Orientation:
(-)
Number of Exons:
1
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-337
NN-scoreoddsWeighted Score
0.6913.0170.006
PositionContextScore
45ERQERKR|SL0.553
TypeScore
nuclear652
GO
*** None ***
*** None ***
*** None ***
Sequence
        1014 bases(100 bases per row)
ATGTCGCTGGGGTTCCTAACCGAGTCGGCACTGCTGCCGTCCAAGGCCAAGGCCATCAAAGTGGACTCCAAGTCGCTCGTGGATCTGCGCGCCGTCGTCT
TTCAGAAGGAGCAGGAACGCCAGGAGCGTAAGCGCTCTCTGCACGACGCGCTGCTTGATGACGACAACAACGACAGCGGATCGAAAGCTTCTACTGCTGC
TACTGGGACTCGCGGCTTTGGCAGGTTTGCGCACTTGAAGGCGACCAAGAAACGTGGCAGTGGCAGTGACATGCTGTCACGGGAAGAGGAGAAGATAGGC
AAGAAGACTAATCGCGGCGTCGAGAAGCGCAGGAAGCAGGACGAAGCTTCCCTCGAGGAGCAGTTGAATGAACACGATGACGACAGGGCGTGGCACAAAA
AGTCGAGAGACATACTCGTGAAGAAAGCCAAGTTATATGACGACATGCTGAATGGACGTGCATCGGCATCTGGGAATTCTTCAACAACAGTGGTAGAGTG
TCTGGTCGACTTTCGCGCGAAAAAGAAATTCGAGGTGAATGCTACATCGACGGAGAAGTCAAGTGAGACTGTGGAGATCACGGACGAGTTTGGTCGCGCT
CGGATGGTCGCGAAAGACGGTGCCGAGTATGCTGAGTTCCTACAGCAGCAAATTCGAAAAGCTGCGGGATCTGTGCTACCCACTATTTCGTCCAAACACG
AGGCAGACCCGCGAACCGAGTCCCAATCTGCTAATGGCAGCTTCGTGGTGTCTCAATGGGAAAAGCGACTGAACTCGCAGGAGAAGATGTACCTGCAGGA
AGTTCATGAAGGCGTAACTCACGCAAAGTCGGCGCATTTCGACAAAAAGACAAGAAAGCAACTTCGTTTGGAGAAATTGCGGCGGCAAACAGATGCTGCT
GCCAAGGAAGAGTCGAAAGTGTTGTCTCTCGAATCTGCAGCAAACGCACAGGAAGAGCAAGCTGCGTCAGTGAAAGCGACCGAGTTTTTGAATCAACTCG
GCTCTCTGATGTGA