Transcript Name :
Pytir_DAOMBR486snap_masked-pir_contig_1-abinit-gene-1.68
Orientation:
(+)
Number of Exons:
4
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-80
158-245
306-339
104-134
269-282
363-758
81-103
135-157
246-268
283-305
340-362
*** None ***
PositionContextScore
371FAYRLKR|VI0.513
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2646 bases(100 bases per row)
ATGCCTCTTGCATGGGGTTTTCTCCCTTGGAGCTTCCTCCGCCCCGCTCGAGTCAACAACTTCCCCAACCAACCGGAACTGCAAGTGCGGGAGGTAGCAC
TCGTGACACCCTTCCAGTCCAAAAACCAGCTCGGATGCGACAACAAAACTTCGACAGACACCCAGAGTCTGGATGCTGTGGCCACGATTACGTCGGTAGA
ACCATGCCGCAGACGTCGACTGCGAGCCTTCCTGGATACCTTCGGCTTCGTCGGAGCCCCGCTGCTGTTCGTGATCTGCGTCTCCATCGCGTGGACCACC
TGGCTCATCGTCCTTAACATCGACCCAAACGCTACGGCCAACTACCTCATGGACACCGCCGAGTTCGACGACGGCGCGTTCTGGCTCATCATTGACCCGG
ACCCGGCGTTTCTGGCGCTGACGTGCGCTGGAATGGGAACTGTGCTGCTCGGGTACTTGTACGCGTTTGCAAGGATGACGATGGGGAGACACCGGAGCGA
AGCCAAATCAAACAGCAAGCCCAGGAAGTTTGTGTCCCAGTTGGCGTACAAGGTCTTTGGTGAGAGCGCAATCTCGACCTGGAGCACGCTCACAGGGTAC
AACGGCGCGAACCGCAAGCTGTGGGCAAGTAGAATTGCTGTGAAGTACATTGTAAAAAGGGTGACAAACCTCTTACCTTGTTGGTAAAATGATGTGGTTG
TTCCGATAGAACACTTGGCTCAAGGTCGTGGACTTGGCATTCCAACTCGTCACGCTCCACCAGATCCTCGAAGCCGGGTTTTCAGCCTCCCTCTGCTATG
CGTACTCAGCACTCATCGCCGCCAACTGCTTCTCCTGCGTCGCCATGATCCTCAACCATACGCGACTATCTGCGTTCGGTGAGGTCCTGATCGATACTGT
GTAGGTTCACTGGCTGCTTTTCTTGATCACCCTCTTTGTTCTGTGCCTCAATGTCGGAAATGCTCTTCTGTGTCAATCATTTAGATTCGATATGCTGACT
GCGGTTGCGGCGCCAATCTACCTCCTCGTGCATAGCTACTACAACTTCCGCTTTGATCGCGAGGCATTCCGCGTTATCTTGGAGTTCGCAGCAGTAAGTG
CGTTTGAGCGTCGAGCGCGGATGAGCGCAGACCCAGTACAGGTCACACAGTTCTTGATCAACCTCAACGCCCTGCGGATCACCACCGCGCTCGGCTTCGT
TCTTCGCATGGGCATGAATTTATCCTTTGCGTATCGACTGAAGCGCGTGATCGAAGTCATGGTGCAGCACGCAGAGCTCATGAAGAAGCAGAATGGCACA
AACGACAGGCAATACTTCTCGTCCGGTCACCTGGTGATGCAGAAAGCTGTTCCCAAATGGATTGCGCTTCCCTTCCTCACCCTCACCTGCGGCGTACTCA
TGTATACTCACGCATGTGTGAGCGCATCGGCGTCTGCGTGCTCGCCACATCCGCAGTGTGCAGCGTTCGCACAGAGAGCGATCCGCCAAGACACCAGCTT
GTGTCCGTGTGTCGCTCTCATTGACGTCGACAAGACCCCAAAATCCTACGACGAGTGGGTAAACCCACCTGACGCGACCGAGACAGTCCGAGCGCTCGCA
GCATCGGGCGACCTCCAGGTGCTCCAGGTGATCAACCGGAAGCTGGTGCAGTTGCCGGAAGAACTGCACAGGTGCACGAATCTGCGGCACATGTACGTTA
GCTCCAATCTCTTCGTTCGTTCAACTCGATTACTGCCTTTGACTGACGCTCCTACGAAACGCTTTTGGCTCTCCAAAGCTTTTTGACACACTCTCAGATT
GAATCCATTCCTGATTGGGCCAAAGATTTTGAGAAGCTCGAGTTTCTGTAAGTCGAAGTGAATACATTTGAGTAACCAACCCTCAGCTCCATGGCAGACT
AATGCTTACCAAATTTTGGCTTGCTCAGAAATATCGAAGGCAAGCCCGAAGCCACGAATCTCGTCAGTATTTCCGACAACTTGCTCACCAAGATGACGTC
GCTCACGTACTTCCACTTGGGGCTGCATCGGCATCTGACTCGCCTACCGCCCTTTGGTCACCTCAGAAACCTCAAGAGCTTGTCGATCGCAGTACTGACG
AGCCTACAGAGTATTCCATCGGTGAAGTTTCTTCGATCACTGGAACGATTGCAACTGCTGTTCCTTGTCAGTGTGCAAGCAGCTCCGGATCTGGGATACC
TCACACGCCTCTCCACTTTCCAGATGAGCGACGCACCAGCCTGCTGCAACGGAAACCTCGGGAAATGCGATAGAACAACACCTGTTTGCAAGCAGGCAAC
CTGCACTACCAGTGACGAAATCGGTGATGATCCCGGCCGTGATCGTTTGTTCGAACGCTTCAGCCAGACCTTCTGCTCGTGGTACACTCCAAATCTCAGT
CCGTACACGTCTGGACCAACCAAAGAATGCATCGATATGTGCGAAGGCGTTACCTACCGCAAATGCGTGGTCCCAGGGACTACAAACGGAACAGCAGCGA
TGTGCTTCAGCAACCGAATGCAAGCGATTGCGTGCAACATTCCTGTGAATCGCAACATCGAGATCCGGAAGAAGCAAATCCTGCAACAAGTTGGGACTCC
CTGTGATCCGATCGAAGAGGCATGGCTTGGGTGCACCGCTGGTTAA