Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-snap-gene-0.46
Orientation:
(-)
Number of Exons:
4
Description :
Nucleoporin
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1308
NN-scoreoddsWeighted Score
0.5641.3950.003
*** None ***
TypeScore
nuclear391
GO
*** None ***
*** None ***
*** None ***
Sequence
        4230 bases(100 bases per row)
ATGTTCCGCGCACGCAAGTTCGTGGAAGTGCCATCGAAGCGCAGCGGCGGGTTGCTCTCGCCCCCGCACCCGGATCTGCTCGTGGCCACGGGTGGCACCG
CGACCACGACGACAGAGAGCAAGCGCCAACGCCTGCAACTCGAAGCCGCCGAGTCGTTCTTTTCCAACAATCAGCAGCCGCAGATGATGATGGCGCCTGC
CGCAACAGTCTCCATGGATGGTGGTCGTGACGATGCCACCGAGAACGTGCTCATCGAGACCCCTGAGTGCACGATCACGATGGTCGACACACTGCCGAGC
TTCATTAGTGACGATATCCGCAAGGAGAATGGCGGGCACAAGCAGCAGCAGTTCCCACAGATTGTATCGTGCCGCGCGTCTATCCCATCCGCGCGCCACA
GCAGCGGGCGCCAGTGGATCGTGTACTTTGTCGTGGTCTTGCGCACGAAGATCCTGCTGTGGCAGGAAGAGCAGGGGAAAGTGATCTCGCTGTCGCTCCC
GGACGAATTAGAGGACCGCGAGGTGCTGAACCCGTTCCTCTTTGCGCTCTACGGACAGAGTCTGTCGCTGATGGTGATCGGCAAGAGCGGCATCGTGCTC
TTTTGGGAAGACATTGATCTCCCCTACGAGAGCGTGCCACTGAGTGTGCAGATCCCGTTGCAGTACGAAGAAGAGGTGTTCACGAACGCCGACGCGATCA
TGTCGACCGTGGACCAGCAGGAGATCTCGCAGCTGCAGCAGTCGCCCGAAGAGGACCTCAAGAGCATCGTGTGCTGGAGCAACCAGGGCAACATCTGGGA
AGTCGCGATGGAGGACCGTCGTATCCGCGTGCGTGCGTTCGAGAAGCGCAACGGTGGCTTCCTCTCGGGACTGACCAAGTCGGTCTCGCAGTTCTTCTTC
GCGTCGGCGTCGCGTTCAAGCAGCGGACAGTACGGAGGGGAATTGGACCCGAACCTCCCGATCAAGTACGTCAAGGTGGTGCCTTCGGTCGCCGACGGAA
TCGTGAGCGACGAGACGGCGGACATGCTCGTGCTGTTCAGCAACGGAATTGTCGAGCGCCGCACGTTCAGCACGGGCGACGTCATGGACTGCTCGTGTGT
ATCAGTGAAGCACTTTGACGCCACGCGCGTGGCGATCAGCTACTTTAGCGACAATTTCCCAGATCAGCACCTCGCGAAAGTGGAGATCGTGTCGCTTCCC
TACGTTCTCGATAACTGCTTTGCGCTGCTCGTGGCGTTCGTGTGCTCCACGAGACAGGAAGCGTCCGCGAAGGTGAAGTACGCAGTATTCCAGTTCTCGC
TCGGATCGACGAGCGAATCCCCCGAACCAGAGTGGGCGTGTGTGCTGGACTACGAGCCATCGTTCTCGGAGGTCGGCGACACGAGTCGCTACTTCCACGT
AGACTGCTTTGGCGTCGCGCGCGGCGCTTTCTACCTTGTGTGGACAAAGGCGCTGCCGATCCAGTTTGCGTCGATCCTGCTTCCGCGCTCGGGTCAGACG
ACTGTGCGCTACGCGGCTTTCTCACTGCAGGGTGTGCACAACCGCACTGCGGTCGGCTTTGGTGCGCGACTGGAGGCGAACGCGTTTGCTGGCGATGCGA
TTAAAGGCTCGGTGTCTTTTGTACTCATGGAGGACGACAACAAGCTGCCTCATGGCGGAACAGTCTGCGTCGCGACTGCATCGAACATGCAGAAAGTGGA
AGCGCTGCCAGCGCAATCGGCTTCGAGAGGTGCCGCCTCGACTTCGCTCCACGAGAAGAGCCGCAAGCGTCTGGAAGAAGCAAGCCGGCTCACGGGCGAG
TCTCCGCACTTCCTCGCCGAGAATCTGGACGTCCAGGAGTATGTGCGTCTGCTGACAACGCATTTCCACGACGACCCGTACTCAACGTCGCCGCTGCGGA
TTGCAAATAAAGACGCGTTTGCTGTTGCCCAAGCTGCTATTGCGATTGATTTCCAGATTTTAGACGCGAAGCCTTCATCGGGTCTGCGATGGGGCAAGGA
AGATACAGAGGGTAGTACCAGTCACCAAACAAAGAAGAATGGTAGCAATCCGGCGTTGGTGACTCCGAAGCTCGTGCGTTTCCAGCTCGAGGAGAAGCGC
ACTCGCCACGTCGAGTTCCTGGATTTCCTTCAACGGCGGTGCGCGAACGTGTGGCAAGTGATCGTCAAATCCCCGGAGCTCAGTCGGTACTTGACAGAAG
ACGAAGAGAAGCTGAACGCTGCGATCTCGCTGAGCAAGTTCCAAGGCTCGCTTCACACTCAAAAGCCCACAGAGGATCCGCTTTCTTCAACCTCTTCGAG
TGGCAGCATCCAGCGTCGATTGACGGGTCAGTTCTTGCTGCACGCGATCGAGAAGACTGTGGAGCAGCGCGGGTACCAGAAAGAGCAGCTCCGTTTGGCT
GGCTACAACGCGTTTGACATCTTCTACTGCGAAGTGAGCAAAATCACTGAGCTGTTCCAGTTGCTTAGCATGGAAGTGCAGAAGCTGGGCACTTCGATTG
GCGAGAGCGACCCAACGTACCTGTATGCGCTCCTGGAAGCTGGATACAGTATGCTGAGCATGCTCAAGCCCTCGTCTGTGAGCTCGGAGTCTCAGGCGTC
TAGTGGTGGCGCGTTCACTGCGACGGGGAGCTGGGCATTCACGCGTCAAGTGCGCGAAGTGATCGTGGACCAGGTCTCCCGTCTGACTGTGCTGGTTGGT
TACTCGACTCTCTCTGGCGAGAAACGCATCCGCTGGGAGAATGACGAGATCTTCGAAGTGACGGACCAGATCAAGAGCCTCGGATGTGTTCTCTTGGATG
GCTACCTGCGCTTTTTGCCAGCTTTGCAGGGCGAAGAAGCCGAAGATCTGCGGAAAGAGTCGGAGCTGAGCAAGCGCTACGTCCTGAATCCGCTCGTGTA
CGTTGCGACGAACACTGCGCTCGACACTGACCGCGCGGGGGACTTTGAGCAAGATGGCTTCCTTGAGCGAAAGCGCAACGAGCTCTTTGCGCAGTGCGTG
AAGCTGTCGGAGAAGTACGCGTACTACGAAGGTATGGTGTTCTTGGTGTACACGGAAGACCAGGCGAACCTGTCCAAGCTGGACTACGTGCTGGGCAAGC
TGCCGAAGAGCGCGTCGACGAAGCGCCTGGAAACGTACTGCAAAGCCTACGACGGGTTTGCGCAGTTTCTGTTTAGCTGGTACGGTGGGGAAGTGCGCAA
CCCGTGGCCTGTCTCCGCCGTGTACGAGCGCAAAGCGCGATCGACGATGCTCGCGTATATGCTCAGCAACTCGAAGTTGTACGGAGGGTCGCTCCATCAG
TACATGAAAGGACACGAGACGCTCTCGAAGAATTGCTGGATGACGGCGATCTCGATCGAGCGCTACGACCAGACCGCGTCGCTTGCTCTCCACGAGGCAG
AGCACGAGCGTTCATCGCTCTCGAAGCGCAAGAATCTGACGAGTCTCGCGAAGATCGCGGCACTCGCAGCTCCAGACACGTCTCGCAACGAAGAAAACAT
GCAACAGATCAAGCGCGAGGTACGCAAATCATTCGTTTCGAGTTGGTTTCTGTGTGGATGTATGGGTTAACCGACGAAGTTGCTTTCTTTTGTCAATGGG
TGTAGCTGGTCCGCATCAAAATCCAGGAAGTGCTACAGCAGCAACTGCCATCAGAGCAAGCTATCGACGCCTCTCGTCCGCTGACTTGCGATGAGCTCGT
GGACATGTGTCTCGAGGCTTCGTTGTCTGTCGCAAGGAACGATCCAATCAGGTACAGATATGTTTCCTTGTGCATTCACATGTGTGCTTTGCAGTTTAGT
CATCTGATATTTGCTTCCACTGATTTATCATTAGAACGAACTTGTTCCTCATGGCGCTGGAAGCCGTAGAGAGCATGCAGGACACGGACTCAGGCGAGTT
TGACGTGGCGCTCGCGAGAGTGTGGCACCACTGCCTCTGCGAGGACGAGGAGCTCTGGGAGAGCCTGCTGCAGGAGTACGCGTCGGGCGTGAACGAGCAG
AAGCTGGAGCTGTTGATGCGCGAGACGCTGCTTTACTCTGCGATGACGCAGTATTTATCCTCCAANNNNNNNNNNGCCGCCAGCACCTGTCGCCGTCGTT
CGCGTCTGCGGCGCTTACGATCGAGATCCTGGACGACTTGATCGAGAACGAAGAGCACGAGCACTCGATCATCAGCGCGCGCAGCCGCCAGCTGTTTGCC
AAGACGCTCAGCTTTGCGATGACGCACTAG