Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-fgenesh-gene-1.14
Orientation:
(-)
Number of Exons:
6
Description :
Oligopeptidase A
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-738
NN-scoreoddsWeighted Score
0.5271.1610.002
*** None ***
TypeScore
mitochondrial696
GO
*** None ***
*** None ***
*** None ***
Sequence
        2684 bases(100 bases per row)
ATGCTGCGTCAATCGCTCCGCGCAGTGTGTGCGCTGCATGCGCACCGCCACCACCACCTCACGCGCAAGATGGCGCTATCCACTCTCTACGTGCGCTCGC
TGGCGTCCGTCGCTTCCAACCCGCTGCTAGAGTGCGTGCGCGAGCGCAAGCTGCCGCCCTTTGAGCGGCTCCAGATCGCGGACATCGAGCCGGCCGTGCA
GGCCGCGGCCACCGAGTACACGCGTGACCTGAAGGCGCTGGAGCAGACTCTGGAGAAGAACCGCGCGCAGCTGCAGTGGCGCGACGTGGTCGATCCGCTG
GAGGTGCAGAGCGACCCGCTGGGGAGGCTCTGGGGCGTTGTCGGCCACCTCATGAGCGTGAAGAACTCGGAGGAGCTCCGCAAGGTGCACGACCAGCTGC
AGCAGCTGGTCATCCAGACGTTCACTGAAGCGTCGCAGAGCAAGACGCTCTACGATGCGTACCAAGCCGTGCGCGACAGTGCTGAGTGGGGATCGCTCTC
GCTGGCCCAGCAGGTGCGTTTATATATGTGTAATTGTGGCAATGCTGCTGGGGGAGTTATTGATCAGTGGCTGATGGGAAACATGTGGCTCTTATTGTTA
TTAGCGAATCATTGAGTTAAGCCTCCGCAGCGCCTCACTGAGCGGAGTTGGACTGGAAGGCGCCGAGAAAGAGCGCTTCAACAAGCTCAAGCTGCGCGCC
GCCGAATTGGTACGTTGCTGCAAATAGCGCTGTTCTGCTTTGGTTGTGCGCTTCCCCCACTCGCTCACTCATTTATTCTTGCAACACATTATGTTTTCTA
GAGCACTAAATTTTCGTCCAACTTGCTGGACGCCACCAAGGCGTTTTCGCTGATCGTCGCCGACAAAGCCGAGCTTGAAGGACTTCCAGACTCGCTCCTG
CAGCTCTTCTCGCAGGTACAGCAGCGCATTTTGTAAGCGTGTTGCTTATCCTATACCGTACTCTCACCGACTTCGTCCTTTCATTCCTCACTACGTAGAG
CGCGCGTGAAGAAGGCCACGAGGCATCCACGGCCGAGAACGGACCGTGGCGCATCACACTCGACCCACCGTCGTACATCCAGTTCATGAAGTACGCGGCG
AACCGGTCGCTGCGCGAGCAGCTGTACCGCGCGTCGTCAAGCCGCGCGAGCGCTGCGCCGTACGACAACGAGGAGATTATCAATGAAATTCTCTCGATCC
GCAAGGAGATGTCGGAGCTACTGGGCTTCCAGACGTATGCGCAGGTGAGCATCTCAAAAAAAATGGCGCCAAGCGTCGAAGAAGTGGAGAAAATGCACGA
CGACCTGCGCGAAAAGTGCATCGAGATCGCGAAGCAGGAGATCGCGACGCTCGCAGCGTACGCGGAGACGCACGGCCAGCCAGGCGAGCTCGCGCCGTGG
GACCTTTCGTACTGGTCGGAGAAGCTCAAGGCCGAGAAGTATCTCTTCTCAGACGAAGCGATCAAGCCGTATTTCCCGCTCGAGAAGGTGCTCGACGGGC
TCTTTGCGCTGACGGCTCGTCTCTTTGGCGTCACCATCGAAGCCGCGGACGGCGAGCAGGAGGTCTGGAATAAGGACGTGCGCTTCTTTAACGTGCGCAA
CGACAAGAGTGAGGTGATCGCGAGCTTCTACCTGGATCCGTTCTCGCGTCCCAAGGAGAAGAACGGCGGCGCCTGGATGAACGTTTGCGTGGACCGCAGC
CGCCTGCTGGGACCGCAAGAGCAGAATGGTGTCCGCAATCCGGTGGCGTACCTGATCTGCAACCAGTCGCCGCCCGTGGGGGACACGCCGAGCCTCATGA
CGTTCCGCGAGGTTGAGACACTATTCCACGAGTTCGGCCACGGCCTGCAGCACATGCTCACGAAGGTCGAGTACGGCGCGGTCGCCGGTATCAACGGCAT
CGAGTGGGACGCCGTGGAGATCCCGTCGCAGATGATGGAGAACTTTTGCTACGACCCCGAGACGATCAAGGCGATCAGCGGTCACTACCAGACGGGCGAG
ACGTTGCCCAACGAGCTCTTCGAGAAGATCAAGGCTGCGCGCAACTACATGGTGGCGACCGTAATGCTGCGCCAGCTGGCATTCGGCGCGCTCGACATGT
ATCTCCACGAGCACTACAAGGGCGATGAGCCGATCTTTGACGTGCAGAAGCGCATCCTCGCCAAGTGAGTAAACTGGTGGTTGAGAGAGGCTGTTTGATT
TGATTGATGGAGGGCTCATGGTATTCTCTGTTGTTGTGCTAGGTACTCGGTGCTGGAGCCGCTGGATGAAGACCGCTTCCTTTGCTCGTTCAGCCACATC
TTCGCAGGCGGCTATGCGGCTGGCTACTACAGGTACGCGAGCGATAAAATCGCCGACTTTGACTCTCTACCCAGCAGCTCAACAACACTATGCATCCATA
CTGACTCGTCTGTCCATCCATCGTGCATTCTTCACCATCCATTTCTTTCAACTAGCTACAAGTGGGCGGAGATCCTCTCGTGCGACGCGTACGGTGCGTT
TGCAGAAGCGGCGCAGGATGCAACCAACCCGCAGGAGGCGCTGGCGCACGTGGGCCGCCGATTCCGCGACACAATCCTCGCGCGCGGTGGCGGCCAGCAC
CCGCTGCAGGTGTTCGAGGCCTTTCGCGGCCGCAAGCCGTCGGTGGCGCCGCTGCTCACGCAGTACGGACTCCTCAAGGCATAA