Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-fgenesh-gene-1.8
Orientation:
(+)
Number of Exons:
1
Description :
Aspartate racemase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-308
*** None ***
*** None ***
TypeScore
cytoplasmic304
GO
*** None ***
*** None ***
*** None ***
Sequence
        927 bases(100 bases per row)
ATGACCAAGGAGCAGCAGACCATGCTCGGCATCTGCGGTGGCGTCGGCCCCGCCGCGGGCGTGTTGCTGCACCAGATCATCCTGGAGCATACGAAGAGCG
ACGGAATGGACCAGGGTCATTTCAACGTGTGCCACTTCTCACGCTCCGAGGACATGACTGACCGCACCGAGTACCTCCAACACATCGCGGAGGATAAGGG
TGTCGATGATATGCGCGCAGATGGAGCAGCTTTGCTGCAGATTGAGAACCCTGCGTGCGGAATGGCGCGGACGTTCGAGATGATGAAGAGTGCCGTTGCA
AGCTGCAATGCGCGCCTCGTCACGGGCGTGCCCTGCAACACTTTCCACGCCAAGCCGATCTGGGACGAGTTCCTGCGCCTCACAGCACCGTCATTAAAAT
CGCCGTGGGTGCATCATGTGCACATGCTCGAAGAAACGGTGCGGTTCATTGCACAATACGCGCCGAGTTGTACCCAGATTGGCTTGATGGCAACGACCGG
GACTAGGGAATCCCGCGTGTACCACGACCTCCTGGAGCCGTTAGGGTACAGCATCATCGAAATCTGTCCGTCACTTCAAACCGAGTTGCATGAGTCAATC
TACAACAAAGTCTGGGGCATCAAGAGCACTGCGCCTGCCGTGAAACCGCGCTGTGTTGCGAATTTCCATCGGTATGCTCGGCAACTGAAGAAGAACGGAG
CCGAGGTGATCGTCATGGGCTGCACGGAGATCCCGTTCGCATTCACCGGACGCAAAAGCTTTGCTGGAGTGCTGCTCATCGATCCGCTTGTCGCACTTGC
GCGCGCGATGATCCGAGAGGCTGACCCTGCGCGGCTGAAACCTTTGGAGCTGGAAGGAAACCGGATTACACCGCTGAACAAGCTGTCGCAGCCCCGATCA
CCCACGAAGTACCACAAGCCCTGCTGA