Transcript Name :
Pytir_DAOMBR486fgenesh-pir_contig_1-abinit-gene-0.181
Orientation:
(-)
Number of Exons:
7
Description :
Binding protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Epsin-like, N-terminal10.274PS50942
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Epsin-like, N-terminalIPR013809
*** None ***
InsideOutsideTMhelix
1-850
*** None ***
PositionContextScore
658SNARSDR|SS0.57
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3181 bases(100 bases per row)
ATGAACCGACAGACGCTGGCCGAGGCCACGAGCCTCCACGATGGCCCCGTGCCCATCTATCTCATGGAGGAGATTGCGCGTACGTGCCCCTTGCTCTGTG
TATATATATGTGCACGTGGTTATGGAGGAAAAAAAGGGGGGAGACTTGGCAGAATGAGCCATTTGAATATGAGGAGACGCTAAATGTGCGGTTTGCGCGT
TTTGTGACGTGGATTGCGCGTACACAGGATCGACCAAGGAGAGCGCGCGTGATGCGGAGAAAGTGGCGGACTTCATGCTTGGCCGCCTCAACAAGAGCAA
TCTGATCGTCAAGTTGAAGGCGCTGCAGCTCATTGCGGTAAGATTGCAATGTCTGATATCTACGCTTTGCATCGTTTTGTATAGTGAGGCATAGACGAGT
GGTCACTCACTAATGTGTTGCTGTGTGTATTGCATGATTCCAGTTCTGCGTTCGTGAGGGAAGTCCTGCGTTTGCCGGCGCCGTCCGCGAAGAAGAGCAG
GAGATCGCTGCGTACCTGCGTGAGTAGCGTGTTATTTGAAGAGAGAGAGGATTTCGTATGCGAGTGAGGCGCATCTAATGACTGTTGTATGTGTGTTGCT
GCTACTGCTGCTGTGATCACAGAGTACACGGGGCCGCCTGATCCGGTCTACGGCGATGAGCGCTACCGTCGAATCCGCGTTGCTGCGCAGGTGGGTGAAC
TTTGTTTCTATATTTTCAGCTGCGCTTTGTGTCGTTATGAATGGCGTAACGACTGAGCAATGTCACTGACTGACTCCTGGTGCCTTTTTATGATTGCAGG
AAGCGTTGGTGTGTCTGAACGACGGCAGTTTGTCCCGCCATAGCGAGCCTGCGCACAACAACATGAGCGCTCCGAGCGGCGGCAACAGCTGGCAATCGGG
TCCGCAGAATGGCGCGTCACCTGCCCCGTATCGGGATCAGCCAGCGTATGGAGGGTCTGCGCCAGCGTACGGAGGTGCGAGCAGCTACGATCAGCAGCAA
CAACAACAAGGACGATTTGGAGGGCCGAATAGCCAGTCACCAGCGCACCCAGGCTCGCAGCCGTGGGGAAACAGCAACAGCGCGTCGCGTCCAGCGCCGT
ACCAGGACACCCCGGCTTCTTCATATGGCAACCCTTCGGGAGGCTACAATGGACCAGCGGGCGGAGCTCCTCCTCAGTACGGTGGCAACGGCAGCTACGG
ACAGAGCGTAGGCGGCTATGGAGGACCTTCCGGTCCTGGCGGGTACGGACCAAACGACGGCGGCAACGGCGGAGGCTACGGCTACAACAACGGTGGTGGC
CAGAGCGCCCCGCCAGCAAGCGGTTTGGACTCGTGGTCCAGTGCTCCTGTCGGCGGCGCGCCAGTTAAGTCGACTGCGTCCGGCATGTGGAGCAGCTCTG
GATACCAGAAGAAAGATCCATCGGCGTCTGCGGATCTCCCACGTTACAACGCATCTCGCTTGGCTCGTGATAACCGTCCAACTGTACTTGTAGGTCACTC
GTTGAACTTTCCGAAGCCAGCGAGCGGGTACAATGGGCCAAGCGGCGGGTATGGGGGCAACAGTGGCGGTGGTGGCTACGGCGTTAGCGGAGCTGCCTAC
GGTGGCAACAGTGGCGGAGTCGGTGGCTACGGTGGCAACGCTAGTGGCGGCGGTGTCTACGGTGGAAATGGAGGTGGCGGCTACGGCGGGAACAGCAGCG
GCTTTGGCGGCAGCGGACCGGGAGGTTTCAACAACCAATCCAGCGGCATGCCAGGCTTCATGGACAACTCGAACAGGTTCAACAGCAATCGTTCAGGCAT
GGGGATGACAAACACACAGCCTCTCCACGTGAACCAAGCTCCGACGACGAAGTTGGGCAAAACGGTCGAAGGGTTGAAGAAGATCAGCAACGAAGCTCGC
GAGCGATGGGACCGTCGAAACATGGATAAGTCGATGGCATCTTCTTTAGCGGACCACGACGAGCTTCGCGCGGGACAGGTGATGGATCGCGGCTACCAGT
ATCAGCCGAATGCGCAGCACGGCACTGGCGGCGGAGACACTAGCAGAGACTATGAGCGCGGTCTTATCGACAACCTCTGCGCATCCGTTGGTCTGTCGCG
CGCACCGCCAGCAGATGCGCTGAAGCGATTCGTGGACTTGGCACAGACGCTCGATGTGCAAACGATCGGTGACATTCTCCTGGACAAGCTCGAAGACCCG
TCATGGCAAGTGCGTCTGAAAGGACTGCACGTCGTCGTGGCACTCTTGGAATCCCCAAATGGCGCTCCATACATGGACTGGTTTGACGAAAATGTTGACG
TGCTGGAAGAGGTACGTTTGTTGTCTGTGCACTGTGTTTCATTTTTCAAGTCACTCATCTCGTAAAATCTATTTTCTATTGTACGAAATCTTGTTTCCAG
CTTCGCAAAGACACCAAGCCCAGTGTGGTGTCCAAGACGCTCCAGGTATTGCGGATCCTGGGCTTCGCGGACGAATCCGAGCCGCAACCACCTGTGCAAA
AGCGTCCGTCTAATGCGCGGTCCGACCGCAGCTCGACGTCGTCTTCGGCAGTGCACACCCCATCGTCGCAAGCGCCAGCGGCTCACCAGCACCAAGCCCA
CGAAGAAGTGGACTTGCTCGGCTTTGGCTCGCTTAGTATCCAGCAGCAACCTCCTGCGCAAGCTATCGCACAACCAAATATCTATGGCTCGCCACCTTCT
GCGCCAGTGCAAGCTCCACCAGCACCACAGCAGGAAGTCTCGGTAAGCTTGTGTGTGAGGTAGCTATTTTCACAATGTCGCACATATGTTTAACACTCTG
TCTGTGCATTTGTAGCTCTTGGACGATTTCGACCCATTAAACAGCTCGAACGGCTCCAACTATGCAGCCCAGCAACAGTACGCCCCACTGCAACAACAGC
AGCAAATGTATGCTCAGCAGCAATATGCCCAGCAACAGCAGTACCAGCAACAAATGTACCAGCAACAACAGCAGCAGCTGCAGCAGGGACTTCCCATGCA
AGTCCAAGCTCAAGCTCCGATGCCAGCGCCGCTGGACGAGCGATCGCAGACACTGAGCCATTTTGGCAAAGACTTGTTCACGATCGCCAATTCGCCGCGC
AACTCGACGTCGTCGGCTGAGAACAACGCTCCTGCTGGTGCTCCTGGCGGTGGCGAGAAGTCGGCGTTTGGGTTCATGTAG