Transcript Name :
Pytir_DAOMBR486maker-pir_contig_1-fgenesh-gene-0.14
Orientation:
(+)
Number of Exons:
1
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-450
*** None ***
PositionContextScore
266RYVRPRR|SS0.655
407DVARTRR|LT0.648
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1353 bases(100 bases per row)
ATGTTGCCAGCGCTCGTGAACAACGTGGTGACGAATGTGCCGCTCCCGTGGAAGCATAGCAGCAGCAACAGCAGCGGCCGTCGCAACAGCAGTGGACGAC
GCAGTAGCAGCAGCGAAGGAAGCGACCTGTTCGACCTCAAGCAGAGCCTTTGTGCCGGCGCCAACGTCAAGCGCACGCGCACCACAAGCTCGCAGATGGA
CCTCGACGACACCGACAACCAGCTCAGCGACGACCTCACGGAAACCGAGAGCGCCGTGTCCTCGTCCTCGCCGTCCATGAAGCAGTACCGCACGCTCAAC
TACGCGAGCTTCGACCCATACGAGACCCAGTCGCAGCAGCAGGCGCCGCTCCGCGCCACCGTGTTCTCCTACGCGCGCGCGGGCCTCAACAGCTCCAAGA
TGCTCTTCGGCAAAATCCCTGCGAGCCGACAGTCCAAGAAGCACTCGCGAAGTGTGAGCGACTTCTCAGACAGCGACTTTGCACCGTTCACGCCCGGTAC
GGTCGTGTGCACCAAGTTCGGGCTCGGAACGGTGGTCGAATTCCGTGAGAGCGATGGGATTACGGCCGTGCAGTTGCAGAGCCGACCACCGATGATGTTG
TACACGGCTGGTGACGACGACGAGTACTACTGCGTGCCAGCTCTTGTCGGTGACTGGGTGCAGACTCCTGCCGGTGAGGGCTGCGTGCTCGGGTATGACT
CGTACGACCAGATGTACGCGATCCGCATCGGCGGAGAGGTGGAGTATGAGTGCCGCGTCCGCCAGGGTGATGTTCAGCGCTACGTTCGTCCGCGTCGCAG
CTCGCTCGGCAGCGCGCCGTCATCGGTGATCCAGAAGGGCATCTCGACTGCTCTCAAGACGATCGCGTCGACCTCTTCGGGCATCTCTGCGTCCACGTAC
CATTTCGTGTCCAACAAGTACTACCACGGTCAATGTGTGATCACTGCTTATGGCTCGGGATGCATTACGGCGCTCGACCCTGTGCAGAAGACGGTCCAGG
TCCAGCTGACGTGGGGAGCGACGGCGTACCTGAATGCCGATATGATCAAGTTCTACCCAAAGGCTTTGGTCGGCATGGAAGTGACGACCAAGTTTGGCGC
TGGTCGAGTTGAAGCCTTGCGGCCAGAAGACGCGATCTACACTGTGCGTCTGCACGAAGTGAAGTACGGGGAGAGCGACATCGTGTACGTCCATGAATCG
GACGTCGCGCGCACCCGTCGATTAACATCTGCGGTCGAGAACGTCCAGAAGCAGGTCCGCGGTCGATGGATGGCGTTTGCGCAGAAGAGATTCTCGAGAG
AGCGCGTTGTGGCGACACGGCCAGAGGAAGAGATCTCCACCGCGGGCATTTAA