Transcript Name :
Pytve_DAOMBR484maker-pve_contig_814-fgenesh-gene-0.2
Orientation:
(-)
Number of Exons:
1
Description :
ATP-binding Cassette (ABC) Superfamily
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
ABC transporter type 1, transmembrane domain13.009PS50929
ABC transporter-like20.008PS50893
ABC transporter type 1, transmembrane domain16.679PS50929
ABC transporter-like16.894PS50893
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain1.3SM00382
AAA+ ATPase domain6.1SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-162
221-286
337-391
833-848
962-1040
186-197
310-313
415-809
872-938
1064-1367
163-185
198-220
287-309
314-336
392-414
810-832
849-871
939-961
1041-1063
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
ATPase activityGO:0016887IEA
nucleotide bindingGO:0000166IEA
integral component of membraneGO:0016021IEA
transportGO:0006810IEA
*** None ***
*** None ***
Sequence
        4104 bases(100 bases per row)
ATGCCGCGCGTGTCGGACGGCGCCGACGGCGCGACGGACAGGCGCGCGCCGCGCGGGGAGCCGGGGGAGCTACTGGTGTACGGCACGTTCGAGGAGGGCG
ACGTGGAGGGCGACGTGGAGGGCTTTTCCGAGCCTGAGAAGCCTGCAAAGCGAGACGGTGAGCGGCAGGCTGAGCGCAGTGAGAAGGCGGATGACGATGG
CAAGCAGCGAGCGCCGTCACTAGTAACGAAGGCGATGGCTCCGAGAGAAGACGGAGGCGACGGCGCGCTGCCGTACCTGCACCCGGAATCGCCACTCACG
CCGCTGTGGCGCAAGATGACGTTCGAGTTCTTCAGCCGCAAGAACCTCAAAGAGCAGCTGGAGGCGGGCGAGATCTGGCGCCTGCCGCGCGCGCTCACGA
CGGCGCTGGCGTCGGCCGAGTTCGTGCGCGTGTACTCTCCCGGAGCGCGCCACGGGCTCAAGCGGGCCGTGCTGCGGACCCACGGGTGGCCGCTCGCATT
CTGTGTGGTGCTCCAGCTCGGCAGCTTGGTGTGCGACGTCTCGACGCCGCTGATCCTGTACGGCGTGCTGCAGCTGGTCGTGTCGGGACAGTACTCGCTG
CTGCAGCTGTCGTCGCTGCTCGTGATGCTGTACGTGTCGACTTTGGTGGAGATCATCCTGCGGTCGCACGCGCATTTCTTCGGCTTCAAAGTGAACGTCA
AGATCGTCGGCGCGCTGCGCACGCTGCTGTTCGAGACGACGATCGGGAACCCGCACCACCAGACGTGCGACCAGGACGGGATGAAGAAGCGCATGGCCGA
GGTCGCGCACATGTACTCGCACGACGTGGTCGCCGGTGCCAAGATGGCCACCCACGTGACGATACTGTGGCGCTACATGCTGCAGATGGGTATCGAGCTG
TACATCCTCGTCCAGGTGATCGGGATCCGCATGAAGCCGATCGCCATCGCGTTCATCGTGCTGACGCTCGTGCTCAACATTGGGTCGCGACTCTCGGCAC
TCCTACACAAGCTGCTCATGCGACAGGTCGCGGTGCGGCTGAACGTGGTGCACGAGTGCTTCAAGAGCATCCAGATGATCAAGCTGAACGCGTGGGAAGA
CAAGATGGGCGAGAAGATCGAGCAGGCGCGCGCCAATGAGCATCACAAGCGCGCCAAGTTGAGCGTCATTCGAGCGCTGCGGTATTGCCTGGGGTCGGAC
TCGCCCAACCTCGCGTCCATTGTCATTTTCGCGTGGATGGCCATGCTGGACGACGAGTTTTCTCCCGTCAAGGTGTTCCCAGCACTGCTGCTGTTCCATC
GCATCAAGGACCATTTCCAATCGATTGTCAATCTGTTCGACCTCACGATCATCGGCCAGACCGCGCTGTGGAAGCTGACTACGTACTTGAACGATTGCCA
TCGCTCCGTTGGTGGAGATAAGAAGACGCTCACGAAAGAGAGATCGTCGTCGAGCGGTGATGAGGACTGGCCGGCGAACAATGCGATCATCGCCATGCAG
CAGGCGTGCTTCGCCAAGACTGCAGATGCGAGCAACCCGTTGCTGCTCAATGTGAACTTTACTGCTCAGAAAGGCGAGCTTGTACTGATCCACGGTAAGG
CAGGTGCGGGCAAGTCGACACTCTTGAACGCGCTGCTGGGGAATGTGCAGTGCGTATACGGAAAGGTGTTTGTGGACCCCGAGTACAAAGTGGCGTACTG
CGCGCAGGAGCCATGGCTGCAGACGCTGAGCATTCGCGACAACATCCTCTTTGGCTCGGACTACGACGAGCAGAAGTACTGGTGTGTGCTGGAGGCTTGC
TGCTTGGTGGACGACTTGCGCAACCTCCCTGATGGAGATGGCACGATGGTGGGTCCGAAGGGGATTAACCTTTCTGGAGGACAGAAGGCACGCATCGCGC
TGGCGCGCGCATGTTATGCTGACGCTGATCTGTACATTCTTGACTGTCCGTTCGCGAGCATCGACCCGATTGTGCAGAATGACATCTTCACCAAGTGCAT
TATCAACCTGCTTCGCCACAAGACGATTGTGATGGTGACCCACAACCCCGAGTTCGCTTCGTCGAGCTTTGTCGACCAGCTTGTCAAGGTGGAGAACTTG
ACGGTGCAGGTGGAATCAACACCGAGAGAGGGCAAGAGCACATCGAGTCGACGAACGGACATGGCCAACACACTGCCACCGTGGAAGCGTCCTGCTTCAC
TGGCGCCTGCTGCTGTTGCTGCTGCAGCTCTGAGTGAGACTAATAATCGCGGTTTGAATATGTGGGAGCCGGCGACGACAAGTCTGTATTCGCGGAAGAA
GCCTGTGGGGTCAGCAGGTTCGAGTACAGAAGATGAACCGACGAAGAAGGGTCAGGCTATGAAGGAAGCGTGCCGCTACTTTACCCGTGACAAAATGGGC
CGCATTTTCCATCGAAGCACCTTGAAGTACATGATTCCTGGCAAGTGTTTCCTGGTGCTATACGCCATCGCCGCGGCTGCCAAAGATGTCTGGCTCATGT
CGTGGAGCGCATCGTCGACGGCGACAAAAGTAGACATGCTTCGGTCAGTGAACATCTACGCGATGCTCGTCGTGAGCTCCGTGATCTTTGGTACGATCAG
CACGATCTTCCATTCCAAGGCTCTCGCAGTATCGGCGAACGAGCTCTTCCGTGACCTGACTGTCGCGCTGCTGCGCGCTCCAATGTCGTTCTTCTACCGC
ACACCTGTCGGCGAGATCTTCAGCCGGTACTTCACGGACATAAACATCGCAGACACCCAGTTTGCCGACTCGTTCTTGGCGGTGTTTCGCTCCTCCGTTT
CGATCCTCGTGTCTGACGTGATCGTGTGGTACTACACTGGCTTTGCCGGGACTGGAGTCGTGGTTATCTTCTTTTTGGCGTTCAAGGAGTTCATGTCGCT
CGGCTTCGTCGCGGGACTGTTGCAGCGCGCGTTCCAGACAGAGGCAGCCAACCTGAACCTGATCTCGGAGGCGCTTGACGGTTCGGCGACGATCCGCGCG
TTTGGACGTGATCAAGTCGCTCGCTTCTGCACCGAGCACGGCGTTATCTCGGACGAGCTCATGCGCGGCCGCTACCACGCACAAGCGTTCAAGATGTTCG
TGCTGGTTCGTTCCGACCGAGTCCTCGGTCTGCACTTGATCATCGTGATCGCTATGATCTCGATGCACAAGATCACGGCCGCGGAGCTCGGACTGCTGCT
CTACTACGTGTTCACCATCAACTCGGACGTGTTCACGCTGTCATCGCAGATGCTGCAGATGCTCACGTGCCGCCTGAACATTGACAAGATCCTGGACTAC
ACCGAGATCGAGCCAGAGGAGCAGTCCCAGCTCACAAATCCTATCGAGGTTGGTCCCAAGTGGCCCACACGCGGCGACGTCGTGTTCGAGCACGTCTGCT
TCGGCTACGACATCAAGAGTCGCTCTCAGGGATCGCTCGCGCTCCAGGACGTGAGCTTTTCGGTCCGCGGCGGCGAGAAGATTGGCGTGGTTGGTCGCAC
GGGGTCTGGAAAGAGCTCGCTCGCAATGGCGCTCTTTCGCGTTCACCCGCTGCAGCGCGGCCGGATCCTCATCGACAACCTCGATGTGAGCTTGATGCGG
CTCGACTCGCTGCGGCGCAATGTGTGCATCCTCCCACAGACGCCGCTGTTCTACCGGTGTACAGTGCGCGCGTACCTGGACCCATTCGGCGAGTTCGACG
ACTCGCAGCTGTGGCGCGTACTGATTGAGTGCGGACTCGACGACAGTGTGCGCAAGCTGGAGGAGGAGCTCGCTGACAATGGCGAGAACTGGAGTGTCGG
TGAACGACAGATGCTGTGTTTGGCTCGCGCCGCGCTCAAGCCGTCGCGGGTTGTGATCCTGGACGAGTCGTTCTCGTCGGTGGACCAGTCGAGCCAGACG
AGGTTGCTGGAGGTGCTGGACAGCGTCTTCAAGCACTCGACCATCTTCCTCATCACGCACCGCCTCGAGGAGATCCTCTCGTTCGACCACATCCTCGTCA
TGCAGGACGGCCGAGCTGCTGAGTTTGGCGCGGCTGAAGAGCTCGCTGCCAACCCGGACAGCATCTTTTACGAGTTTCTCGAGACGACTCTGCTCACATT
TTGA