Transcript Name :
Pytve_DAOMBR484maker-pve_contig_708-snap-gene-0.6
Orientation:
(+)
Number of Exons:
1
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-510
*** None ***
PositionContextScore
239AVVRKKR|MK0.52
249RLSRLRR|RK0.551
252RLRRRKR|RK0.655
253LRRRKRR|KR0.522
255RRKRRKR|IG0.63
284HVDRSPR|EV0.555
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1533 bases(100 bases per row)
ATGCCGTACGAGGACGTCATCAAGGAGAATTTGGAGTATTTTGTCAAGAAGCTGTACGAAATCTTGCAGGTGGTGGAGGCGTCGATGCAGAAAGATCCCA
GCAAGAAAGGCATCCGCGCGTTCTCACTTCTACCATATTCGAGTTCGTATGCCGCAGCGCACATCGTGATCAACGGGTCAACACTTCACGGCTTCTGCGC
AAGGATTTTCAAGGCAACTGGCGGACAGAATCCATTGAACATTCCGTTGACCAAGACGGGCGTATTGGTCAAGAAAGAAGACGTGTGCAAGCAGAAGGAG
TTATTGCTGCGTCGCGGTTTTGCAGTTTCCCAGTTCGAGACCATGTTGCCGACTTCGACTATCTCCAAAGCCGTGTTCGACGAGATGGATCATGCTTCGA
AAACTCCCTACGCCAGTCGACTGTTCGATAATCAGATCACGACGAATGGGTACAGCGCGTCTGTGCTGTTGACGCGGCCGAAGAACGCGTTGGAGCTCAA
GCTGGAAGAGCTGAAGGAAGAGCTGAAGGAAGAGAGGAAGAAACAGAAAACCAGCTCGAAGAAGGATGGGAACTTATTTGATGACGCGTGGCAATTGCTT
CCAGACGACTACGAGGCGGACATGGTGATTGGCATCGATCCAGGGATGAAATCACTCTGTACGGCGGTGAGCGAAGGCGGGATTTGTGTTTCCCAAGCAG
TCGTGAGGAAGAAACGAATGAAGCACAGGTTGAGTCGACTGCGAAGGCGGAAACGTCGGAAGAGAATCGGTCCAACACAGATCGCCAAGAAGCGTCAGCG
ACAGCTGCGGAAAAGTCTGAAGAAATCGCGACACGTTGATCGATCTCCACGTGAAGTCGACAATCAACTCATTCATTCAATCACTACGAGAGAGTATCGA
CATCTCGCAGGGATGAACAAGGCGCGCTTCTGGAACGAGAACTTGATGAAGCGCGAAAAGAAGTACTCCGACACGATCAGTCGTATTCCTTCGTACAAGA
CAGCCAGTTTTGACTTGTACTTGGAACGACTGAAGATCTTCTGGGAACACGTCAACTTTCTTCTTGAGTTCTCTGCGAAGCACGCGTTCCTCAAGTGGCA
ATTCTTCCAATCATGGATGAAGAATAAGGCGCTAGACGCTATGGCAAAGCGCTTGATACCAGTTGCGAGTCCGCGAGCGCTCGTCGGCTACGGCGACTGG
AGTCGTCGCGACAGAATCTCAGGTCACGCTCCGACTCCTGTGAAAGGATTTCGCGAGGCGCTCAGGAAGCGAGCGACTGTCGTTCCCATCGACGAGTTTC
GTACAAGCAAGCTGTGCTCGTGCTGCCACGGATCTCTCGAGAAAGCCTTTCTTCCAATCAAGGAAAATGGCGACTTCGTCTTGAAGAAAACCAGATTCGT
CTTGCGCTGTTCCTCCAGTGTTTGCAGGGCGACGTTGTGGAATCGAGACGTCAACGCTGCGCGCAACATTCTCTCTCTGCTCAAGAGCAAGTTTCAAGGA
TTGGAGAGACCAACGGCGTTCTGCCGAGCGTAG