Transcript Name :
Pytve_DAOMBR484fgenesh_masked-pve_contig_593-abinit-gene-0.24
Orientation:
(-)
Number of Exons:
1
Description :
3'5'-cyclic nucleotide phosphodiesterase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
3'5'-cyclic nucleotide phosphodiesterase1.7PR00387
3'5'-cyclic nucleotide phosphodiesterase1.7PR00387
3'5'-cyclic nucleotide phosphodiesterase1.7PR00387
3'5'-cyclic nucleotide phosphodiesterase1.7PR00387
3'5'-cyclic nucleotide phosphodiesterase1.7PR00387
3'5'-cyclic nucleotide phosphodiesterase1.7PR00387
*** None ***
HmmSmart predictionP-Valprediction_id
GAF domain6.7SM00065
GAF domain1.8SM00065
GAF domain5.3SM00065
HD/PDEase domain0.005SM00471
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1040
NN-scoreoddsWeighted Score
0.5021.0920.002
*** None ***
TypeScore
nuclear348
GO
Biological ProcessGO IDPrediction Method
catalytic activityGO:0003824IEA
protein bindingGO:0005515IEA
KO ID
K13757
*** None ***
Sequence
        3123 bases(100 bases per row)
ATGAACGACGCCAATACCAAGACGCTGCTGGTTCCGGCGGACGCGCTCCGCATTGTGCTGCAGAACGCGCGGGCCCATGAAAACGAGAAGCGCGAGCTGC
AGGCGCAGGTGGACGAGGCCGTGCGTCGTGTGCGCGTGCTGAGCGCCAAGACCGCGGAGGTTGAGCAGCAGCTCGCTCAGTACCGGACCAGCCATCGCCA
GAGCGATCTGTCGTTCGGCAGTCCACATGTTTCACGTTCTCCCCCGAAGCGAATGGCAGCCGTGGCCAGCGGTCAGGGACTGGGGCTGACTCCGCCGCTG
TCGGTGGCGACGGAGCGTGTGGCGCAGCTGGAAGAAGTCGTGGCGTCCGTGAGAGACATATCGTCCCAGGGCAACTTCGACACCGTCATCGTGAAGATCC
TGCACGCCGCCGAGAAGCTCGTGCGCGCCGACAAGTACACGCTGGGAATCCTGAACGAGCGCCGCAATGTCGTGGAGATCTTCTCGACTGAGCCGGAGCA
GCTCGCAGGTGCCAGCGACGCAACCTCCCCAGTGAACGAGGGTTTCATCGCCGCGGACTCGCCCACGACATTCGGCCGCGTTCTCATGACAGGGAAGCCG
CTCAGCATCGAAGACTTCTTCGCGCACGAGAACTACGAGCGTCAGATGGAGATGACAGGCATCACACCGCACGCTCTCTTGTGTCTTCCGATCCGCAACG
CCAACCGCTCAGTCGTCGGTGTTCTCCAAGTTGTCTCGACTGCGCGGACAATATCTCCAGCAGTGGTCAGCAAGTCAGGAACCAAGCGGCTGCCGCTGGC
CGACTACACGCCGACGCGCTTCCAGGACACCGACAAGCAGATGCTCGAGTTCCTCGCCGTCGTCGCCGGCGCTGCCATCTGGAACTTGATCTTGTCGCGC
GAGCGTCAGACGGCGCAGAACCGCATTGAGGGACTTCTCAAGCTGCACCGCAATCTCTCGATGGAGGCCGTGTCGTCTGCCGTGCTGGATCAGGTGCTCT
CCGTCTGCCACGAGCTGCTCGGCACCGAGCGCATCGGACTCTTCATGAAGATGGAAGGAGAGAACGAGCTGTACATCGCCAGCGCCGCCGACATCGTGCG
TGGCGAGTATGTGCCGATCGCCAAAGGTATTGTCGGCTTCGTGGCGCGCACGGGCGAGACCATCATCACCAACGACGCGTATTCTCACCCCATGTTCGAC
CCGACGCTCGATCTCAAAACTGGCTTTGTCACTAAGCGGATTCTGTGTCTGCCAGTCAAGGCACCGGATGGCACCATCCTCGCCGTGCTCTCGGCCGTCA
ACAAGGTCGACGGCACAGACTTCTCCCACGAGGACGCCATCTTCCTCAACTACGCCGCAGACACGGTCGGCACGTCGCTGTACAAGGCGAGTCTGCTGCA
CGAGGTCAAGACGGCGCAGAAGCTGATCGAAGCGCGACTTCAGCTCACGACCTTCATCGCCGAGAGCACCGACATTGCCGAGTTCGCCGAGTTGGTCATG
CAGCTCGGCAAAGACATCATGCAGTGTGACCGCTTCGGACTGTTGCTCATCGACCACTTCAAGAAGGAACTGTGGATCACACCGCAGATCGGCGGCGAGA
GCATCCGGTCGCCGATGAACCGCGGTCTGTCGGGACTTGTAGCCACAACTGGTGAACCCGTATGCACTCGTGACGCGTACAAGCACGAGCTCTTCGACCC
GAGCGTCGACCTCAAGACAGGCTACCGCACCACGAGCGTGCTGTGCATGCCCATCTTCGAAGACCACGCCGCGTCGAATCGCAAGGTTGTCGCCGTCGCC
ATGTGCATCAACAAGAAGGAAGGCTCGCACGTCGTCGCCTTCACCAAGTTCGATCGGGACACCATGACGAAGTTCTGCAGCGAAGTGCAGTTCGCGCTGG
GCCGGCTCTCGCTCGACATCTCGTACTACAAAGTCGTGTCCGACTGTGTGGCTGACAACGCCGCCTCTGCTCCACAAGCCACCGGTGCCCCGCTCTCGCC
CCGAAGAATGCCGTCGACCAATCATGTCGATCCCTTCTCGGAGGCGGACATCATCTCGTCGATCGTGCACAAATTCTGCTGTGTGAGTGCACCAGACGAC
TTGCTGGCGACCAGGGAGCCGCTCTCGCTCGCAGCACTGGTGCCAATAGTCAAGCACAAGCAGCACGAGGATGACGTGGTTCCATTCCCGCGTGACATCG
TCTTCGCGCAAGGTGTCAGCGAGCCGCTTGACCAGTGGGACACGAACACTAGTGTCTTCTCGAGTAGTGATATCGTCATGTGCTGCGGCATCATCTTTCG
AGCGTACGGTTTCTTGGAGTACTTCCGCATCTCGGGCGATAAATTCGCGACGTTCGCGTCCAATGTGGCCAACTACTACCGCAGCAACCCGTTCCACAAC
TTCCAGCATGCCTTCCAGGTCATGCTCACCATGCACATCATGATCCGCACCGAGTGCCGCAAGTTCTTCAGCGGGTTCGAGATCTTCGCCATGCTGATCG
CCTCCCTTTGCCACAACATTGACCACCCTGGGAACACGAACGACTTTGAGCTCAAGACGCTGAGTCCCATGGCGCTCACTCACAACGACGACGCTGTGCT
CGAGCGCCACCATTGCCGCGTCACCTTCATCATCCTCAATCACAAGTCGGCCAAGATCCTCCAGTACCTCGACGTCGACCGCTACCGACGTATGCGGCAG
CTCATCATCGCTTGCATTCTCGCCACCGACATGTCCAAGCACTTTGAGAAGTGCAAGGTTCTCGAGAGCCTCACGCGTCGCCAACTCTCGGAGAAGCGAG
CAGTGCTCTTGGGGATCCTCGTGCACGCCGCCGACCTATCACACCAGGCGCTGCCGTTCCAGCAAGCGTTCGCCTGGAGCCACCGCATGCTCGACGAGTT
CCAGAACCAAGCAAAGGCGGAGGCGGATCTTGGGATCCCCACAGACTGGTTCATGCAGGATCTCGACAGCCGCCGCACGCGGCTCACGGTGCAGCTCCAC
TTTATCAACTACATCGTGCGGCCCATCTGGCTGCCGCTCACGTCGCTCTGTCTTCATCTTCGAGTGCGTCTCCATTGCAGCAAGCTTGGCGGTGTATTTC
TTGGTTGCCTGACTAATGTTTGA