Transcript Name :
Pytve_DAOMBR484maker-pve_contig_519-snap-gene-0.25
Orientation:
(-)
Number of Exons:
3
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-636
NN-scoreoddsWeighted Score
0.5446.1280.012
*** None ***
TypeScore
nuclear739
GO
*** None ***
*** None ***
*** None ***
Sequence
        2042 bases(100 bases per row)
ATGCAACCGAGCCGCCGGAGCGGTCCGGGGCCGCGCGACCGGCGACCGTACCATTACGCGGCCGCGGCCGGTCCCCCGCCGCCGTTCGCGCCCCCGGTGG
CCCAATCACCGGCCGTACCGCAGCCATTCCTGTCCGCGGGTGGCCCAATCCCCATGGGCTTTGGTGTCAACTTGTTCACCCCACCACCACCTCAACCACC
GCAGAATCAGCCACAGAATCAGATGAGGTTCTGGCCCATGGACCAATCACAGCAACAGGCACCACCACCGACAGCGTTCAAGTCCGTCGACCTCGAGATC
AGCGAGATCCTCGACTCCGGAGGAGCCCCCGACGTCGGCCCGCCTCCAGTCCCCGCGGACGCCTTCGCCTTCGCCCCGCAGGTGACGCAGCCCAGCCCGC
AGCCGCCGTCGTCCGCATCCCGTCCGCGTCCAGCGCGACCAAGGAAGCCGTCCGCGTCCGCGGGGATGGCCGTGTCCGCATCGTCCGCGGGGATGACCTC
GGTCTCAGGTGCAGTCTCAGGTGCAGTCTCAGCAGTCTCAGACGAACCAGATCTGAGCCAGCGCAAGCTCGACGAGAAGAACGAGAAGTGCCAGTATGCG
GGGTGTCCGAACCGCGCGCGGGTCGAGCAGGTGTATGGCAAGTTCTGCAACCGGCATGTCATCGTGGCGCCGTGCGGCTTCCCTGGCTGTCGCGAGCGGG
CCATGGCGCGTGCCTCCATGTGCGAACGTCATGCACTCGAGGGCAAGGACGCGCTGCATCAGATCCTGAACGCCAGGGCTCAGAACGTGCCCGTGTGTCG
CACCTTTGGCTGCTTCAAGAACGACCAAGGCCGCGGGTACTGCCGCGGCCACGAGAAGCTGCTCATGGCGACGGGAAGACTGCCCAAGCATATCAACAGA
CGCAGAGTGAACAACGCCTACACCATGTGCAGCTACCCAGGCTGCGCCAAGCACTCGCAGCGTAACCACTTGTGCAGGACGCATGGCAACCTGGTGATGA
AGCAGGCCGAGGAGCTCGCGGCACGCGGCGGCTCGAGCGAGTCGTACGACGAGATCCTGCTGCGCCTGCAGAAGGACATCCGCCGGTGCTCGCACCCGAG
CTGCACCAAGAACTCGCAGCGTGACCGGCTGTGCACCATGCACTACTACGAGAAGCACAACATCCCCAGGGACGGCAAGGCCGGCCAGGCCCTCGCTCAG
GCGCAGCAACAGCATCCAGAGCAACAGCTACAGGGACCAGGAGCAGTACAAGCAGCTACTGTGGTGGTGGGGGACGCGGAGAACCGGCCCGGTGTGGGCA
ACGCCGTGGCCGAGGCGACCGCGATCCGCGACGTGGAGCGCACGCGGTGCGTCGCGTCGGGCTGCAGCAACGCCTCGTTCGTCGGCGGGCTCTGCGCGCT
GCACGGCAAGCAGCCTCCGCTATCACTGTCGTCGTCGTCTATCCAAGCGCAGGACCCGCAGCTCCAGCCAAGGTAGGTGGCTCGCGTGTCTTCTGTTTGA
GTAGTGGCGCCTTCCGTCCCCAGCGTGGTGGCCTAAGTAACCCCGCAGGGCCGACGCCCCCGTCGTGCGTGTGTCCGTGACGTTCCCAGGCGCAACTAGC
CCCGTGAGCCTCGGCAGCAACCCGTCGTCCCCCTCGGAGGCCAATGGCGGCATTGACGGTGGCAATGGCTCGGCGGCGTGCCGCGTCCACGGGTGCGGGA
TGTCCGCCGAGCTCGCGGGCCTCTGCGCGACCCATCTGCGCGCGTTCGAGGCCGGCGCGCTCCCCATCGACCGCGTCACGCTCGCGTCCAACGTGCTGCA
CGAGCAGAAGCTGCAGGCTGCCGNNNNNNNNNNNNNCCGAAGCCGAGGCCGAGGCTGCCCGCGCGCTCGCCAGCGCCAATGCTATGAGTTCGAATGCGAG
CGGCGCCGCGCCGGCGAGGAAGTACTTTTGCCGCGTGGACGGCTGCGGCCGGCAGGCGCAGAAGCGCGGGCTGTGCAAGCGCCACTTTCGCGAGCAGGAG
GGCACGACCGTGAGCGCAAGCCAGCGGCAGGAGCAGCCCTGA