Transcript Name :
Pytve_DAOMBR484maker-pve_contig_519-snap-gene-0.18
Orientation:
(+)
Number of Exons:
5
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-452
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1646 bases(100 bases per row)
ATGGAGCGCATCTACTCGGCCTTCTTCACGCCGCCCGACCGCCGCAAGGAGGCCCTGCCGCCGCCTCCCGTCACCACCAGCGCGACCCGAGACGAGTCGG
CGGCGGACGCGGCCAAGTTCGCGGCCGTGCGGCGCGTGGAGCTCGAGAAGCTCGTGCAGAACCGCGTGGAGGTCAAGCGCGACCTGTTGGCGGCGGTCCG
CGCGGCCGTGCGCGCCTTCGTCTACGCATACGGCGCCAAGGCGTTCACGGCGCTGCTGCTGGCGTCGCGCAGGTGGAGCAGCCTCGAGTACGGCTACGCG
GACGCGGCGCGGCTGCTGCTCCGCGCGGACACGCTGCGGTTCGGCGCCTTCTTCGGCTCGCTGGTCGGCGTCTATCGGCTCTCGGAGCTCGCAGTGCGGT
GCTCACGCAACGGGGAGCGAGACGCGACGACCAGAGCCATCGCTGGCGGTGTGGCGGGCCTCGCGCTGCTGGTGGACGCCCCCGCCCGCCGCTCGACGCT
CGCGCTGTACCTGTTCGTGCGCATGCTGGACGTAGTCGCGCGCCACCTCGTGGCCGTCAAGGCGCTGCCGGCGTGGCCGCATGCGAGCGAGTCGCTCTTC
GCGCTCAGCAACGTCGCCATCATGTACGCGTTCGTTGTCGACCCCTCGCTGCTGCCCAAGGTGCGATACATCGAGATGAGACCGCCAGGACGCATTGTGT
CGCATTGTGTCGCATTGTGTTGCTTGGTTATGCGCCTAACAATGCTGGTAATATGTTGTATGTGCAGGGGTACTACCAGTGGATCTGCCGCATGGGCGGC
GTTAACCACCAAGGACTTGAGTTCACCGTCCGCCAGCGGATGCGCGGCCAGCTCGACGCGGCCGGCGCGCCGTTGCCCTTCCGCCCCTGCCAGCCGCACT
ACCACATGTAGACTCAAGCTTCGAGTAGTGATCGCTCGAGCCAACACCATCGACTGACTCGAGCATTGGCTGCTTGTGTTGGTGGACTGTAGGGAGTCGT
GCGTGACCCACGCCGTGACCGAGTGGGTCAACGGCCTCGGCCGCTCACTGCTCATCTACCTGCCCGTGCACGTGCTGCCGGCGGCCATCTTCCGCTTCCC
GCAGCTGCGGCGCGCGCCGGTCGCCATGCCCGTCAAGATCGCCTTCGCCGCGCTCTGCTCCTCAGCCTTCCTCACGTCCTACCAGGTCAGTGGGCCGCCA
ACGTCAACCGCATCAAGCCACCGCTGACGTTGTCATGTCATTTCCCATCAGACTCTGGTCAAGCTCGTCGTGTGCACCGTGCGCAACGCCTTCCACCGGG
ATTTTCCCTCCGTCTCGGTCCTCGCGGGGGTACGTGGCTCATTTCCCAACTCGCTCAGTGTCGTCCTCGTCTCATGCTGTGCATGTATGGACAGCTCTCG
ACGGGGCTGAGCCTCTTCTTCGAGCACCCGAAGCGCAGGTTCGAGCTCATGCTCTACTGCGTGCCCCGCGCGCTCGACATTGTCTGGCAGGCGCTCGCGC
GCCGCGGCCTCGTGCGGTACGTGCGCCACAGCGAGGTCGCGCTCTTCTGCGTGTCCATGGCGGCCATCATGGCCAGTCCGGCCGCCCACTTCAAGCCCAC
GTACCTGCGCGCGCTGCGCTTCGTCTTCGGCCGCGACGTTATTTAG