Transcript Name :
Pytve_DAOMBR484maker-pve_contig_449-fgenesh-gene-0.3
Orientation:
(-)
Number of Exons:
2
Description :
Arabinan endo-1,5-alpha-L-arabinosidase A
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.7060.82122
InsideOutsideTMhelix
1-322
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1037 bases(100 bases per row)
ATGCCTCGCCTCTTGTCCCTCCTCGCCGGGCTGCCGCTGCTGCTCGCCGGCCTAGTCAGCGGGTACACGAACCCGAAGCTCTGCCAGGGAACGTGCTCGA
ACGCGCACGACCCGTCCATCATCCGTCGATCCGATGGCACCTACTTCCGCTTCTCGACCGGCGGCAAGATCGCCATCCACTCGGCGCCGCACATGTACGG
ACCATGGACGTACCTCGGCGCGGCACTGCCCGACGGCTCCAAGATCAATCTGGATGGCAACGACGATCTGTGGGCTCCAGACGTGCAGAAGGTTGGAGAC
TACTACTACCTCTACTACTCGGTGAGCACGTTCGGCTCTCAGAGCTCTGCCATCGGCCTCGCTCGCTCGTCCACGATGGACTATGGCACGTGGACGGACT
ACGGTAGTGCCGGCATCACGAGCTCATCGTCCAAGTCGTACAACGCGATCGATCCCAACCTGATCCAGGTCGGCAGCTCGTACTACATGACGTTCGGCAG
CTACTGGGGAGGCATCTACCAGGCTCAGATGAAGTCGACGCCGACGGGTGTGAGCGGCTCGTCGTACAACATGGTGACGTCCTCGGACGGTGAGGTGGTG
GAGGGAGCCTACGTGTTCAAGTACGGTAGCTACTACTACCTCTTCTACTCCAAGGGTCAGTGCTGCGGCTACGACTCGTCCAAGCCGACGTCTGGCAAGG
AGTACAAGATCATGGTGTGCCGCTCGTCGTCCGCGACCAGCGGCTTCAAGGACAAGAGTGGCACGGCGTGCTCGAGCGGCGGCGGCACCATCGTGCTCGA
GTCGCACGGCCACGTCTACGGTCCTGGCGGCCAAGGCGTGTACGAGGACCCCACGTACGGCCCGGTGCTCTACTACCACTATGGTGCGTCAACTCTTGGA
TATGAGTGCTCCGATTGCTTGACTGATCGTTGGGGTGTTGTGCTACTGCAGTCGACACGCGGATCGGATATGCCGACGGCGACAAGCAGTTTGGCTGGAA
CCAGATCGATTTCTCGACGGGGTGGCCCGTTGTGTAA