Transcript Name :
Pytve_DAOMBR484maker-pve_contig_361-snap-gene-0.13
Orientation:
(+)
Number of Exons:
1
Description :
Dynein heavy chain
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Filamin/ABP280 repeat-like14.685PS50194
HmmSmart predictionP-Valprediction_id
Filamin/ABP280 repeat2.7SM00557
AAA+ ATPase domain0.84SM00382
AAA+ ATPase domain0.23SM00382
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Filamin/ABP280 repeat-likeIPR017868
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
nucleotide bindingGO:0000166IEA
*** None ***
Cluster Id
6
Sequence
        12315 bases(100 bases per row)
ATGGAAGCCGAAGAATTGCCCCCTCCGAGGTGGCGTCACTCGGCAGTGCTGTTCGGCAAGCACCTGGTCGTATTTGGGGGCTTCGCGGCCGAGAAGCGCA
TGAACGATGTGTGGCTCTTCCACACGGAACTGAAGGTGTGGGAGCAGAAGCACGCGGGCGGCGGCATCTGGGAGGGTCTGCCCCAGTGTCGCGGCGCGCA
CACAGCAACGCTCGTGGGCGAGAAGATGGTCGTGTTTGGCGGCTACGGAGGCAACGGCTTCGGCCGCACAGACTTCAACGACCTGCATGCACTCGACCTT
CAATCATACCGATGGGAAGAGATCCCTGCTGATGGCGGCGGCGAGAAGCCCGAGCCGCGCTCTGGTCACCAAGCCTGTCTCGTGGGCGATGACCAACCCA
AATTGCTCGTGCTCGGCGGCTGGAACAGCCTGCGTCAGTTCCAGGACATGTTCGCATTCGAGTTTGCCACCAAGTCTTGGAGCCAACTGGAGGTGCACCT
GCCAGCCCCGACGTGGAATCACGCGTGTGTAGCCGTTGGTGCCGTGCCGCACTGGAAGGTGTTCATGTTTGGTGGGAACTGCGGCGATTTAGCTGAGGGA
GGCAGCGGCGGTGTACAGGGAGCCTTCCTGAATAGCGCGTCAGTCCTGGACACGGGCAAGATGGTGTGGCTGAGTCCGCCAGTCAAGGGCGACATACCCG
CAGCACGCGCCGACACTGCTCTCGTCTTTGATCGCACAACGAATCACTTGCTGCTCTTTGGCGGGTGGGCGAACCGCTGGTTCAATGATCTGCGGGTGCT
CAACGTGAGCGAGATCGTTGGACCGCCGTACGCGATAGCGAGTGTCGAACCAGCGAGTGGCCCCATCACAGGCAGCGCCAAGCTCAAGATTAAAGGCTAC
AACTTTATTGGGGCGTCCGGCGCAACGGCCACGACTGCGAGCGTGCGGTTCGCGGTCGCCAAGGGGTCTGTGGATGTGCAAGGTGCGGTTATGAGTCCGT
CGATGCTTCAAGTGACAGCTCCAAGCTTCGAGAAGTTTGGACCGCTGCTCGCTGAAGTGCGCATATCGCTACCTGGAGGTATGCTGACGAACGTGGCGGC
GACCTTTAAGTTCCACTCGGTCACGGCTGCGCCGAAGACGCTTGCGTTCGGGCCGTGCCTCATCCACGCTGTGAGTGAGGGTTGCCTCGCTCAAGTTCCA
ACCACTTTCATCCTTCAGGCGCGAGACAAGGACGATGTGCCGCGCGACTGCGGCGGGGACGAGTTCGTCGTGACCGTGACGAGGACGGAGAGCACAGGTG
AAGTCGGTGAATCGACTGAAGACACGCCAGAATCACCACCACAAGCAACGCCGACTATCACTGACCGAAATGACGGCACATATGTGGTGACTCTCGTCGT
ACCAGCACCAGGAGCATATCAGATCGCGGTCGACTTCCAGGGTACATTCGGTGGGATGGCGGGACCCGTTCGCGGCTCGCCTTTCGTGGCGCAGTTTAGT
CCGCTTACAGACGAATCGCGTGCCAAATGTCTGCCGCCAAGTGCAACACCCAAGGACCTCGAGTCGCCTGATCTGCTACGGCGAGTGATGGCGGCCATGA
ACAAACGCAACGGAGACTTCCGTCGGCTGCTGGTGGATCTACGCAAGGATATTCCGAGCAACGAGGCCGACGGGTTGGATACTCTGCGAAAGGTGAAGGA
GATTGTCAAGAAGCTCGAGACGGAACGCGAATCCAACCACCTCGTGCTGGACCAAGTGCGCCAGTTCTTTGCGCAGATCAAGAATTCTGGCGGACAAGTG
GACAAGGAGCTCACCGAGCTCGACGGCATGGAGAAACTGTTTGCGGATGTCGAGCGCCAGGTGCCCGTAACAGAACAACGTATCCAGGAACCCACGCGCA
TGTTTGGCGAGAAGACGGAGGAGAAGATGGTCGCGTACGAGAAGACTATCGCCAAGCGGATGGAGACGATGAAAACCCTCGACTTTTGGTCCTCGAGCCT
CGAACCAGACAAAGGACAGGAGAAGATCGCGGCATACCTTGTGGACTGGGAGGCCGAGATGCGGCGGTGCGAGGAGAACACGAAGCTGTGCGGCGTGTTT
GGGTTCCCTCAAGTCATGAACGAGTCGCGACGCATGATGAGTCTCATGCGTGCGGACGCCGAGGGGATGAAGGCTGTCTGGGCTATCATCAAGCGCGCCA
AGAGCTTCTTCCAGGCCACGAGCGAGGTGCTGTTCAAGCAGGTGGACGTGAACACGCTGCAAATTGAGATCCAGTCGATGCTCAAGGAGCTCAAGAAGAT
TCCGAAGGAGATCCAGTGGTGCGACGCGTACACGTCGATCCTGAAGGAGTGCCAGGCGTTCGACAAGACCCACCCGCTGCTGCGCTGCGTGGCTGCGAGC
TACATGCGACCGCGTCACTGGAAGCGGATCATGGCGAAGACGGGCGAGTTCCCGACCCCCGACGAGGATCCCGAGCAGCGCCTCGGGCTCATTATGAGCA
AGAACCTTCACAGCTTCAGCTCGGACATCACCGAGATCTGCTACGAGGCCGAGAAGGAGCAGGAACTCGAGCTGCGTCTGGTGGAACTCGAAGGCATTTG
GGCTGAGGTGAACTGGGAGATGACGCCTTACAACCCGTCCGCAAGCGAAGCCGACCTCGTCCCGCTGCTCAAGGTGTCTGAGGAAAACTTTGAGCTGCTC
GAGACCCACCAAATCGATGTGCAGGGTATGGCGGCCTCCCCTTACCAGTCCGAGTTCGAGCCGCGCGTCGCCAGCTTGCAACTCGGACTCGCGTCCATCA
ACGAAGTTGTCGTGCTGCTAGGCGACATTCAGCGTTCGTGGAGCTACTTGGAGCCGCTGTTTATCCAGTCGGAGGAGGTCAAGAAGCAGCTTCCCGAGCT
CACAGCCGACTTTGAAGACATTGACGTCGATGTGCGGAAGATCCTGCGCGTCGCGTGGGCGGAGCTGAATGTGCGTAGAGCGTGCACGGAGCCAGGGCTT
ATCAAGCGTCTTGAAGCCATTGTCGAAAAACTCGAGCTGTGCAAACACCGACTCAAGGAGTTTCTGGACGGTCGCCGCCGACAGTTCCCTCGCTTCTACT
TCATGTCGGAGGCCGATCTACTCGACATCCTCTCGAACGGTTCCCACCCGGACCGCATCATGCCGCACTGCTCCAAGATATACCTCGCAACGAAGACACT
AACCCTCGTAGACAGCGGCGAAGGCGGACGTCCCATGGCGACCTCGTTCATTGCCGGCGTCGGACATGAAGTCGTGGACTTTGTTGAGCCACCAGTGCTC
AACGGCGAGGCCGAGATCTACCTCGAGACAGTCATGCGCGCCATGCGGCTCACTCTGTTCAAGCATATCGAGCGTTCGCTTGTGGCTTACACCGCCATGC
CGCGCACTGAGTGGATCAACTACAAGGATCCTGACACGGACCGGTTGGTCGACGCCGCGCAGATCATTTTGCTCGCCGCAGGCGTGCACTACGTCAAGGA
GGTGGAGCGCGCGTTCCGCGCCATGACCGGCGACGGCGACAAGGACGCGCTCAAGACGTACAACTCGCTGCAGGAGAAACAGCTCGAGGATCTGATCCGA
CTCACACAAAGCAACATCACGTCGGCCGAGCGGCAGCGAGTCATGGTGCTCATCACGATGGACGCGCACGGTCGCGATATCGTGGCCAACATGGTCCGCG
CGGGTGTCAACGACGCGACGTCCTTCCAGTGGCAGTCGCAGCTGAAGCACTACTTTTCACCGGCGCAGGGCAGTTTCCTCAAGCGTGACGTCACTTTCCG
CGGCGCCAACAATGAGCGAGCGCAGATTCTGATCGCCGACGCTGGCATCCCGTACGACTACGAGTACCTCGGTAACGGACCGCGGCTCGTCATCACGCCG
CTGACCGACCGCATCTACGTGACAGCTACGCAGGCGCTGAATCTCATGATGGGATGCGCACCTGCGGGTCCTGCAGGAACGGGAAAGACAGAGACGACCA
AGGACTTGGCCAACGCGCTCGGTAAGGTGTGCTACGTGTTCAACTGTTCGCCTGAGATGGACTACAAGTCGCTCGGCAACATCTTCAAGGGTCTCGCGTC
CTCGGGGTCGTGGGGTTGCTTTGACGAGTTCAACCGTCTCGTGCCGGAGGTGCTGTCCGTGTGCTCGGTCCAATTCAAGGCCGTGTGCGATGCGTGCAAG
GCCGACGACGTCAAGTTCATCCTCGAGAACGACGAGGTGATGCTCGACCCAACTGTCGGCGCTTTCATCACGATGAACCCTGGCTACCTCGGCCGCTCGG
AGCTGCCTGAGGGTCTCAAAGCGCTCTTCCGACCCATGACCGTCATGGTACCCGACCTGGTGCTCATCTGCGAGAACATGCTCATGGCTGAGGGGTTTAC
TCAGGCCAAGATCCTCGCGTCCAAGTTCTATGGCCTCTACTCGCTGCTAGGACAACTCCTGTCCAAACAGATGCACTACGATTGGGGTCTCCGTGCCGTC
AAGAGTGTGCTGTGCGTCGCCGGCGCCTTCAAGCGCGCCGAGCCTGACATCCCCGAGACAGATCTGCTCATGCGCGCGCTGCGTGACTTCAACATCCCCA
AGATCGTGGCCGAGGATCTCGTCATCTTCTACGGGCTGTTGGGTGACTTGTTCCCGCGCGACGCGCCGAACGTGGACGTGCGTAACGACCCGCCGCGCAA
GCGAGACATGGAACTCGAGGCCATGGTGCAAGGAGCAGCAGAGGCGATCGGCAACACTCCACGACCCGAGTTCATGCTCAAGGTGGTGCAGTTGTCGGAG
CTACTGGCGATTCGTCACTGTGTGTTCGTGATGGGACCGCCGTCGAGCGGCAAGACGGAGACATGGCGCACGCTCAAGAAGGCGCGTGAGCTCATGGGTA
CCCCCATGGAGGTGCAGGACCTGAACCCCAAGTCAGTCAGCACGAACGAGCTGTACGGCTACATCGTGCTGAAGACGCGCGAGTGGAAGGACGGGTTGTT
GTCCAGGATCATGCGTGATCTTGGGTCGCGCCGACGTGATAACGGCGATGAGGACACGAACCCCAAGTGGATCATTCTGGACGGCGACTTGGACGCCAAC
TGGATCGAGTCGATGAACTCGGTAATGGACGACAACCGTATGCTGACACTCGCGTCCAACGAGCGTATCCCGCTCAAGCCGCACATGCGCATGATCTTTG
AGATTCGCGACCTGGTGTACGCGACTCCGGCGACCGTGTCTCGCGCTGGCATCCTCTACATTTCGACCTCCGAGGGTTACCAGTGGCGGTGTTTGATCGA
CAGCTGGCTTGACCGACACGCGCAAGAACCGGCGGACCATCGGCAGCGCAACATGATGTTCACGCCCGACATTCGCGCCAAGTTTCAGGGACTGTTCGAC
CAGTATATCGAGCCGACGCTCAAGTTCTTCCGGAAGAAGCTCGTTCCGATCGTGCCAGTGGAGGAAACGACGCTCGTGACCAACTTGCTCAACATGATCG
ACTGTCTGCTCACGCCGGCGGTGCTCGAGGACTTTGGCGTGATGCAGCACAACTTTGTGTTTTGCTGTGTCTGGGCGATCGGGTCCATCCTGACGGTGAG
CGACGATGGCACGGACTACGCGGCCGAGTTCAGTAACTGGTGGAAGAATCAGTGGAAAGACGTCAAACTCGTCGCGTCGGCAAGCAACACGGTGTTTGAC
TTCTGGCTCGACCCGGAGACGGCCAAGTTCAACTCGTGGTCCAAGAGCCCGTACTTTTACACGGAGACGTACAAGTCGCCTAGCCCGATCAACCAGATCA
CGGTGCCCACGACCGAGACGGCGTCGATCGCGTTTTGGCTCGAGAACTTGCTGCTCAAGAGTGTGCCTGTCATGATCTGCGGACCGGCAGGCACGGGCAA
GACGCAGAACATTATGGGAATGGTCAAGAAGCTGAGCAAAGAGGACGGCGTGACGCCACCCGCGTTCCGGTACTCCACCATCAACTTCAATTTCTACACG
ACGTCGACGATCCTGCAGCAAGCCATGTTCACGCAACTCGAGCGGAAGACGGGTGCCAACCTCGGGCCGCCGGGCAAAGCGCGGCTGATCTACTTCATGG
ACGACCTGAACCTGCCAGAAGTGGACCCATACAACACCCAGAGCGCGATCTCACTGTTGCGTCAAGTGATGGAGTACCGCCACTGGTTCGATCGGCAGAA
GCTGCAGAACCAGAACATCCTCAACACGCAGGTCGTCGCCGGCATGAACCCGACGGCAGGCTCCTTCCTTGTGGACCCGCGTCTGCAGCGCCATTTCTGT
ACGTTTGCAATGGGTATGCCCGAGGCACCGAGTCTTGTAACCATCTACGAGACGTTCCTCGGTGGCCATCTCGCTGGCTTCGACGCCGAGCTGAGCAACT
CTCAGTTCGCCAATTCGCTCATCAAGGCGGCGCTGAGTCTGCACACGAGTGTGGCGTCGACGTTCCGCAAGACAGCGGCCAATTTCCACTACGAGTTCAA
CGTGCGCCACCTGTCGAACGTCTTCCAGGGTCTCATTGCGTCCAAGAAGCAGCGCTTTTCGACCGCCGACAAGTTTGTGCAGCTCTGGTTGCACGAGAGC
GAGCGCGTGTACGGGGACCGACTCGTGTGCAAGGCCGACATTGAAAAGTACAACCAGCTGGTGCAGCTCCAGGTCAAGCGGTCGTTCCCGGCGTGCAACA
CGAGCCGGTACTATGCAGCCGAGAACGCGTGGCCTCTCATGTTCTGCCACTTCACCAAGGAAGGCGACACCGAGTACGATCAGATCATGGGGACGAACTT
GGACGACCTCAAGCTCAACCTGAACGCGCAGCTCAGGGACTATAACAACAACGAGAACAATACGGCCATGCACCTCGACCTGTTCGACGACGCAGTCAAA
CACGTCGCTCGCATCGTCCGCATTCTGCGCAACGAGAGCGGCCACGCCATGCTCGTGGGCGTCGGCGGTAGCGGCAAGCGGTCGCTCGCTCGACTAGCTA
CCCATATCTGCGGCTACACGGTCCGCCAGATCACCATCAGCTCAAAGTACGGCGAGAACGAGTTCAAGGAGGATCTGCGGAAGATGCACCTCGCAATCGT
TGATATGCTTTCGCGCAACGAAGAGGACGGCGGACTTGTCTTCATGCTCACTGACTCGCAGATCACGAACGAGAAGTTCCTCATCTACCTGAACGACCTG
CTCGCGTCTGGCGAGGTGCCGGACTTGTTTGCGACCGAGGACCTCGACAACATTGCCAATACGCTTGCGCCTGCAGCTGGCACCAAGGATCGCAAGGAGA
TCCTCAAGTTTTTCCAGGCCGAGATCCGCAAGCGGCTGCATGTGTGCTTGGCGTTCTCCCCCGTGGGCGATGACTTCCGGAACCGCGCACGCAAGTTCCC
GGCGCTCGTCAATTGCACCGTGATCGACTGGTTCCAGCCGTGGCCGAAGGAGGCGCTGCTCTCGGTCGGACGCGAGAAGCTCAAGGAAGTTGGCGATCTG
CTCGGCTCGGACGATGCGCGTGCCGGTATCGAGAACTTCATGCCATTCTCGTTCCAGTCGGTCAACCTGTGTGCCGAGCGCTTCTTTCAGGTTGAGCGGC
GCCATGTGTACACGACCCCGAAGTCGTACCTCGAACTGCTGCAACTGTACAAGAAGATCCTGCGCAAGAAGGTTACCGAGTACGGCGCGGCGATTGATCG
ACTGGAGAAAGGTCTGCAAAAGCTGAAGGAGACTGGTGACACAGTCGCTCGACTCGAAGTTGAGCTCAAGGTGATCTTGGAGGCTGCCGAGGACAAGAAG
GCTGTGGCGTCAGCGATCGCCGAAGCCGTGAACAAGGAGAAGGCGAATGTTGAAACAGAGAGTGCAAAGGCGAACGAGGAGGCCGCTAAATGCGCTGTCA
TCCAGGCCGAAGTGACAGAGAAGCAGCGGTCGACACAAGAAGATCTAGCCAAGGCTGAACCAGCCGTCGAACAAGCCATGGCGGCGCTCGACTCGCTCAA
CAAGAAGGATCTGGGCGAGTGTAAGACCATGTCGAAGCCGCCTGCAGGCGTTGACGACATCTTTGGAGCGACTATGGTGCTGTTGGCTGGAGTTCACCCG
AATGTCCAGGTCACGAAGGCTGGCAAAGTGAAGGATGCCAAGTGGGACTCCGTCAAGAAGTATCTGTTGGGCAACATCCCGGAGTACATTGAATACCTCG
TGGGGTTCAAACAAGTGGTGGATGATGGCAAGGTGCCTCCGCAAAACTGGAAGGAGGTGCGCTCGTATCTCGAGATGGAGCACTTCAACTACGATGTGAT
CCTGACCAAGAACAAAGCTGCTGCTGGCTTGTGTTCATGGGTTGTCAACATCGTCACGTACTACGACATTGTCATCACAGTCGAGCCCAAGCGCCAGGCT
CTTGCTGCAGCCAATCTCGAGCTCGAATCGGCCAACAAGCGACTGGCTGAGGTCACATCACTTGTTGCCGAGCTGCAGGCTAAGCTTGATAAGCTGCTCG
CAGACGCCGCGGCCGCCGACAAGGAGAAGGAGGAAGCTATCAACGCCGTCGAAGCTGGCAACCGCAAGATGAAGCTCGCGGGGACGCTCACGAACGATCT
GTCGAGCGAGAACGTGCGGTGGGGGATCAACGTGCTGCAACTGCAGAAGGAGAAGGATCTGCTGGTGGGCGACGTGCTGCTTGCCTCGGCTTTCATCTCG
TACATTGGTCCGTTCACCAAGCCATTCCGTGACGAATTGTTGTCCAAGCACTGGGTGCCGTACCTTCGTAAGGCCGCGAACGGCGAGAGCATCGCAATGT
CGGAAGAGGCCAACCCGCTCGCGATCCTCACCAACGACGCACAGATCGCCGAGTGGAACACGCAGAAGCTGCCATCAGACCGTGTGTCGACTGAGAACGG
TGCGATCGTCGTGACGACCGTGTCCATGGGTCGTCGACCGCTCATCATCGACCCGCAGCTGCAAGCGATCGCCTGGATCCGCGAGATGGAGGCAGCGCAG
AATCTCATCATCGTGAGGGTGGGTCAGAAACTCTGGATCGAGCGGCTCAAAGCGGCGATCGGTACAGATGGCGCCTTCATGATCGAGAACCTCGGCGAGA
AGATCGATCCGATTCTCGCGCCTGTCATCCAGCGGTCCACCTCTCGCCGTGGCGCGCGCTATGAGATCCAGATCGGCGACGCGTCCGTGCCATACAACGA
CGGCTTTCGACTGTATCTGCACACGAAGCTGGGCAACCCGCACTATCCGCCTGAGATCCAGGCGGAGTGCACGATTGTCAACTTTACAGTCACGGCGCTC
GGACTCGAGGACCAGTTGCTCAACCTCGTCGTGTCGAAGGAACGCGCCGACCTGGCGGCGAAGCGCGAGAAGCTGATTCAGGAGCAGAACCAGGGCAAGA
TCGAGCTGAAAAAGCTCGAGGATGATATCCTGTTCTACCTCGCGAGTGCCGACGACGACATTACCAACAACCAGCCGCTCATCAGCATTTTGAGCGACAC
GAAGCACAAGGCGCAAAAGACGCAGAACAACATGGAGGCCGCCAAACGAACGCAAGAGTCGGTGAACCACACGAGCGAGAAGTACCGGAGCATCGCGGCT
CGCGGCTCGCTGCTCTTCTTCCTCATGAACGAGATCAGCAAGGTGCACTCGTACTACATCTACTCCCTCGCGGCTTTCCAGCAGGTCTTCCTCTCCGGCA
TCTTTCGCGTGCCTATGAATGCTAATGCGAGCGGTGGCGGCGATGGAGAAGCTGGAGCTCCAGCTGCTCAATCGACTGATGATGGTGAAGGTGGAGGCGG
TGATGGCGGTGACGGTGACGCCGCTGGTGGCGAGGAAGCTATCGAGCTTACGGACGAAGAGATGGCAGCTCGTTGCATCGTGCTCATGGACAGCATCACG
TCGTGTGTCTACAACTACATTCGGCGCGGACTGTTCGAGCGCGACAAGCTGACCGTCGCGACCATGCTGTGCCTCAAGATCTTGATCAAGGCTGGACATC
TCCCAGACGCCGAGGTTGATGCATTCCTGATCAGCAAGTCTCACCCTGATCCCGGTAGTGCTGGTGCTGCGAGTGAGTGGCTGCCAAGCGCTATTTGGAC
CAAGGTCAAGGCACTCGAGGGTCAGCTGAAGTGTTTTCAGGGACTCGGTGACGCCGTCCAGAACGATCCAGATGAGTGGCGGAAGTGGTTCGCGGCCGAA
GACGCCGAGCGGTTGAAGGTGCCGGGTGATTTCACCAAGCTCTCGCCTTTTCAGCGCATCATTCTGCTACGTGGGATGCGTCCCGACCGCGTGACGAACG
CGCTGCGCACCTTCATCCTCGAGTCGCTAGGGGAGGAGTATGTGACACAGCCGCCGTTCGACATGGAGGCGACGTTCGACGAGACGACGTCGGCGATCCC
GATCTTCTTCGTGCTGTTCCCTGGCGTGGACCCGACGCCGTGGGTCGAGAAGCTCGGTCGCTCCAAGGGTGTGTCGCTCGAGTTCGGCAACTTCATCAAC
ATCTCGATGGGTCAAGGCCAAGAGGCGTACGCAGGCGAGTCGGTCAAGAAGCTGAGTGTGGACGGCGGTTGGATCATCCTGCAGAACGTGCATCTGATGC
AGTCGTGGCTGCCGACGCTCGAGCGGCAACTCGAGGAGCTGGCGACTGAGGGTGCTCACGCCAACTTCCGTTGCTTCATCTCTGGCGAGCCGCCACCGCT
CCCCGACATGCTCAATATTCCCGAGTCGCTCATGCAGAGCTGCATCAAGGTGGCGAACGAGGCGCCGTCCGACATCCAGTCGAATCTGCGGCGCGCGTGG
GCCAACTTCAGCGAGGACACAGTGCAGTCGTGCGCGACGCCATCGCCCTTCAAGGCCTGCCTCTTCGCGCTCTGCTGGTTCCACGCCATCGTGCTCGGAC
GCCGCCGCTTCGGGCAGCAAGGGTGGAGTCGCGCGTACAGCTTCAACACGGGCGACTTGACCATCTGCGCCAACATTTTGCGCAGCTACCTGGACAACAA
CGCGACCGTGCCGTGGGACGATCTGCGCTATTTGTTCGGCGAGATCATGTACGGCGGCCACATCACGGATGCATGGGACCGACGCACCAACAACACGTAC
CTGAGCGTGCTCATCAACCCAGGGCTGCTGTCGGGGATGGAGCTCGGACCGGGGTTCAAGTCGCCTAATCCGGACGAGTTCGCGTTCGCCGACTACGCCA
ACTACATCGAGAAGCACATGGTGCCGGAGGCGCCGCCGCTGTTCGGGCTGCATCCGAACGCCGAGATCGGGTACCTCACGACCACGTGCGAGACGCTGTG
CTACACGATCGTGACGATCGGTGGCGGAGGCGGTGGAGGTGGCGGCGGAGATGGCGGCGGCGGAGGCGGACAGGACAAGACCGCGGTGCTGCGATCAGCC
ATCGACGACTTTGAGACGCGCTGCCCGGAGTTCTTCAACATGCTGGACGTGGCCGAGAACGCGACGCCGCACCTGACGGAGGAGCACGGACCGTTCGTGG
TCGTGGCCATGCAGGAATGCAGCCGCATGAACGTGCTGCTCGAGGAGATCCGCACGTCGCTGTCGGACCTCAAGAAGGGTCTGAACGGCCAGCTTAATAT
GTCCCAGGCGATGGAGGACCTTGCGACGGCCATGGCGCTGAACGAGGTTCCCGGACGCAACCCGTTCTCGCAGTGCAAGTGGGAGAAGAAGGCGTGGCCG
TCCAAGAAGTCACTCTCGGGGTGGTTCTCCGACATGATCAAGCGCCACGCGCAGCTCGCTTTGTGGGCCACCGACTTCGTCACGCCGCTCTCCATCTGGC
TGCCTGGCCTGTTCAACCCGACAGCGTACACGACCGCGTGTCTCCAGGTCACATCGCGCCGCAAGCTCATGCCGCTCAACCAGATGACGGTCGAGACGCA
CGTAACGACGTTCCAGGACCCGAGCCAGGTCACGTACTACCCGGACGACGGCGTGTTCGTGCACGGACTCATCCTCGAAGGCGCGCGCTGGTCGACAGCC
GACGAAGTGACGGAGCGCGTCAAGATTGGCACGTCGCCCACGACCGAGTGCGGCGGCACGCTGCTGGACAGCAACCCGAAGGAGCTGTTGTGGACTATGC
CGGTCATGTACGTCAAGGCCGTGCAGACGCAGCCGCAGTGGGAGCCGTCGTCCGTCGGGTACCTGCGCCACGACCCGCAGGTGTACGAGTGTCCCGTGTA
CCTCACGCGCTTCCGCGGCCACACGTACATCTTCCTCGCGACGCTGCCGACGGACTGCGGCCGCGAGAAGTGGGTGCTCCGCGGCGTCGCCATCATCTTC
CAGGACGACAACTAG