Transcript Name :
Pytve_DAOMBR484maker-pve_contig_361-fgenesh-gene-0.7
Orientation:
(-)
Number of Exons:
2
Description :
DUF1168 domain protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-204
*** None ***
PositionContextScore
134SDKRKRR|KE0.536
*** None ***
GO
*** None ***
*** None ***
Cluster Id
4575
Sequence
        698 bases(100 bases per row)
ATGGGCCGCTACACGACCGTGCAGACCTACACGGACCAGGACGCCAAGGTGGCGGCCATCTCATACTCGTCAGCGACGACCGCTGGCGCCGACAGCTCTG
CCAATGCAGCGGCCGCTTCTCCGACCCAGGCGGAGGCTCCTGCCGCGCCAGCCGACGACCCGAAGAGCGACCGCTTCCACATCAACCGCGTCGACAATGT
GGCCGGCAGCTCGGCGGGCGCCGGCAGCGGCGAGTTCCACATGTACCGCGCCGCGCGGCGGAGGTTTGTCTTACTGTTATTATTTTGATATGGAGGGTGT
GCTGCTATGGGACTCGCGGCTCACGGAGCGGTTGGTGTCTGTGCAGGGAGATGGAGCGGATCGCGACGATGGAGAAGCAGTTTGTCGCCAAGCAGCAGCA
GGACGAGTTCACCACCAAGCGCAAGCGCAACGCGGACGAGTTTGAGGCGCGAGCGCACAAGCGTTCGGACAAGCGCAAGCGTCGCAAGGAGCGGCAGAAG
GCTCGCGCGCTGGACGCCGCCGCGAACGAGGACGAGCAAGCTGGTGCGGACGGAAAAGAGACGGAGAAGCACGAGACGGAGCCGGCCGTGCTGCCGACGC
CGGGTGGCGTGGCGGAGATCCCGAACGACGGCAGCTTCCTCGAGCACATGCTGGCGCAGCAGAAGGCCAAGGAGGCAGCAGGCGAGCAAAAGGAATAG