Transcript Name :
Pytve_DAOMBR484maker-pve_contig_304-snap-gene-0.15
Orientation:
(+)
Number of Exons:
4
Description :
Myosin
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Myosin head, motor domain7.2PR00193
Myosin head, motor domain7.2PR00193
Myosin head, motor domain7.2PR00193
Myosin head, motor domain7.2PR00193
Myosin head, motor domain7.2PR00193
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site8.444PS50096
IQ motif, EF-hand binding site7.291PS50096
IQ motif, EF-hand binding site7.144PS50096
IQ motif, EF-hand binding site7.272PS50096
HmmSmart predictionP-Valprediction_id
Myosin head, motor domain6.2SM00242
IQ motif, EF-hand binding site0.74SM00015
IQ motif, EF-hand binding site93SM00015
IQ motif, EF-hand binding site15SM00015
IQ motif, EF-hand binding site210SM00015
IQ motif, EF-hand binding site14SM00015
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1453
NN-scoreoddsWeighted Score
0.6022.1390.004
*** None ***
TypeScore
nuclear739
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein bindingGO:0005515IEA
motor activityGO:0003774IEA
myosin complexGO:0016459IEA
*** None ***
*** None ***
Sequence
        4656 bases(100 bases per row)
ATGGACGTCGGCGCACGCGTGTGGGTCTCCGACCCGGCGGACGGCCGTGTGTGGCGGCCCGCGCGGCTGCACGCGGTGGACCGCTCGGCCGCGTCCGTCT
CGGTGGTGTTCGAGGACGCCGCCGGCCAGGACGAGGCCGAGGCGGCCGCGGTCTGCGTCATCCCGATGGCGTTCAAGCCCAAGCATGGTGATGGACGGAA
GGACGCGACCACTGAAGAGCGCGAGGTGGCCAACGTGCTGCTGCAGAACGCGGCGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTGGCGCTGCCGCACCTGCACGAGGCGTCCATCCTGCACGCGCTGCGGCTGCGGTACGCGCGCCACGCCATCTACACGCACATCGGCGAGATCCTGCTGT
CGGTGAACCCGTTCGAGCCGCTCCCGGAGCTGTACGCGTGGCCGCAGATGTGCGAGTTCGCGCCGGACGCGGCCGTCGGCAACAACGAGCCGCACCTGTT
CGGCGTCGCCCGCGCCGCGTACGTGGATGTCGTTCGGAACGCGCGCAACCAGTCGATCCTGATCAGCGGCGAGAGCGGCGCTGGCAAGACCGAGGCCACC
AAGATCCTCATGAAGTACTTTGCGCTCACGTGCGGCCAGGGCGTGGGCGGGTCCAAGCCTTCGTCGCCTACCACGAAGGGCCCTCCGTCCACGACCAAGA
CGTCGCTCGAGGCGCGCGTGCTGCAATCGAACCCGATCCTCGAGTCGTTCGGCAACGCGCGCACCGTGCGCAACGACAACAGTAGTCGCTTCGGAAAGTT
CATCGAGCTCCAGCTGGACCCGCGGCGCCACCACGCACTGCGCGGCGCGCGCGTCCGCACGTACCTGCTCGAGAAGATCCGCGTGATCCGGCAGGCAGCG
GGCGAGCGCAACTTCCACGTCTTTTACGAGCTGCTCGCTGCAGCGGACGCCTCGGTTGATTCCACCGAGGACACGCACAGCCTGCACCAAGACCACTCGG
AGCTGAGCGTCGCTGACCAGAACGCAGATGCCACTGACCGCGCGCTCTTCCGGCTCGCAGCCGATCACCGAGACGACTGGGGGCTCCGCTCGCCGCTCGA
CTTTGCGTTGCTCAACCAGAGCGGCTGCTTTGAGCGCCGCGATGGCGTGCAGGACGCCGTTCAATTCCGCCGCACGCTGCGCGGCATGACGCGACTTGGT
CTGGCTCAAAGCGAGATCCGCAGCGTGCTCGAGATCATCGCTGCTGTGTTGCACATGGGCAACGTGAAGTTCGCCGAAACACAGCGAGACAATGTGCGCG
CGGCTGTGGTGGTGGACAACGTTGCTGACGACCCGTTCGAGTCGTTCCGCCGCTCGGCCGAGCTGTTGGGCGTGGCACAAGGTCCGTTGGCAGCCGCGCT
CACTCGTCGAACTCTGCACACCGCGGCAGAGACACTCGAGGTGGCACTCGACGCCACGCGCGCGGCCAACACTCGCGACGCGCTCGCAATGGAGTGCTAC
CGCCTGCTGTTCGACTGGCTCGTGGGCCGTGTCAACGCTCGACTTCAGCCGGTAGGGATGTCGGGCGAGTCGGCGTTCATCGGGCTGCTCGACATCTTCG
GGTTCGAGGACATGGCGGTCAACTCGTTTGAGCAACTCTGCATCAACTACGCGAACGAGGCGCTACAGCACCAGTTCAACGAGTCCGTGTTCGACCACGA
GCAGCAGCTGTACGCAGACGAAGGCATCAAGTGGGCGTTCGTCGACTTCCCGAACAACGCCGCGTGCCTCGCGCTGTTCGAGAAGAAGCCCGTGGGACTC
TTCTCGCTTGCTGACCAAGAGTGCGTCTTTCCGACTGGCTCGGACCGCGCGCTCTGCACCAAGCTCTACCTCGAGTTCGACAAGAAGCAGCCTCATTTCG
TGGCGGCAACAGCCCTCAAGCGCCAGACGCACTTTGGCATTGCGCACTATGCCGGGACGGTGCTCTATGACGTCGCCGATTTCCTCGTCAAGAACAAGGA
CGCCTTCGGTGAAAGTGCGGCGCGATTGCTCGCGCAGTCGACCAACCCGCTCATTCAGTCGCTCGCCGTTGCCGCCGCTTCGCCTGGTGCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNATGCTGAGTGGCGGTGCAGATGACGAGGACGACTCTGAGACATGGCCTCGACCACGCCGCGCGTCCACTTCATCGCCAGC
ACCTCGCGTGGCGATCCGCCGCGCACACTCGAGCATCGCTGCCACAAGTGTCGGCTCCCAGTTCAAGTTGCAGCTCGGCGAGCTGCTGACGATGATTCGC
TGTACGGCCCCGCGCTACGTCCGGTGCATCAAGCCTAACGACCGGAACCAAAGCGGCACCTTCGACGCTCGCCGCGTTGTTGAGCAACTGCGCAGTGGTG
GTGTGCTGGAGGCGGTGCGCGTCGCTCGCGCAGGGTTCCCCGTCCGCCTTTCGCACGACCACTTCCTTGATCGATATCGCCGCGTGCTGCGTGCGGCTGA
CGAGTCCAACCCATCCAAATCCGACGACGATATTGTGACGAGTCTGGCGCGACTGATGCGGGTTCTGGAGCTGCCCGGAGACGGCGAGGGCGGTGTGAGC
CTCGGTCGTACACGCGTGTTCTTTCGGCGCGTCCCGTACGAGCTGCTGGAGTCGCTGCGAGCCACAACGCGGGCCAAGGCCGCTGTGTCGATCCAGGCGG
TGGCTCGCGGCTACTCGGTCCGGTATCGGTTCGAGTTGCTCAAGTGCGCGGTCGTGACCCTGCAAGCCATTGCGCGTGGCCAGCGCGCGCGCTCGTGTGT
TCTCGCGATGCGCCAGCACCTCAAGGCTGTGGAGCTCCAGCGCATGGGACGCGGATTTTGCGCTCGCCGCAAGTTCCTTCGACTTCGCGCTGCTTCACTG
GCTTTGCAGAGCCACTGTCGCCGCCGACGAGCTGCTCGGTGCGTCCAAAACCTCCGTGAGAACCGCGCGGCGACACGACTTGCAGCCTGGTGGCGATGCG
CTTATGCTGCGTACACGTACAAGCGGCTTTTGAGTGCGGTGCTTTCACTGCAGTGCGCTGTTCGGGCTTACTCGGCGCGTCGTGAGCTGTGGACCTTGCG
GCAGCAGAGTCGCGACGTGGCGAAGCTGCGCCAAGACAACTCGGAGCTCAAGAGCGAGCTGGCAGCGTTGCGCGAGCAGCTGCGCGCAATGCAAAGTGTG
TCGCGCTCTCCCGAGCCGGTGGCGCCAGTGTTGACGCTGGAAGAGCCGCAGGAGGACGATGCGGGTGACGAGAGCCCTTCGTTCCTGTATCAGACACCGG
GGTCGGCTTCATGCGAAGACATCAGCAACAACCAAGCTGAGGGTCCCTGCAACCCTGTGGGTATCGACGAGGATAAGCTAGTCGACATGAACGAGCCGAC
CACGCCGACGAAGGGCGGTGCTCCAGTGGCTCCATTGCCACCGTCGCGGACACAGCGTGCGCAACGCTTCAGCCTCCCGGATCTGTCGCTACCTGTCGCC
AACACGGAAGATGACGCCGACGTCGACCCGACTGACGACCAAGAGGAGGAGGAGGAGGATGACATGGCCAAGCCACGAGACCGCCGCCAGAGTCTCAATT
TGTGGCTCGAGCGGCAGGAGCACGCCGAGGAGGAGGTGGCTCAACTCCGCGAGGAGCTGAAGGCGTCAGCGCTGGCCGAGTCACCCGTTGACGAGCAGAA
GGCGGCCATGCGCGCGTACGTGGCGTCTCAAATCAAGTCGACTATGATCAAGCTGCAAGCCGCCGAACCGGCCGAGCTGAGCCTCGACCTGCGACTCGAC
AACAACGACGAGGACGCCAACGAAGATGAGCTCCCCACGCCTCCGCTTCAGTGGCGCGCTCCTGCGTCCATCAGCTACACCATGCGACCTTCAGTCGGGT
CGGCTGTGCGTCCATCGCTTCGCCGCCTCGATCTCATCAACCCGAACACGCCTGTCGCCGTGCCTGTGGCTGCACTGGCAACACCGAGCCGCGCTCGACC
GCACGTCGTCGGGATCAAAACCGACCGTCGTGGACCAATGACCGGGTGCGGTCCCGCCAACACTGGCCGAGCGGCATGGAACTTCGCGGCTGCATCTGTG
GCCAAGGCACAGTCGCAGTCGACCAAGCACAGCCACGGTCTGCAGGCGTACTTCGCCGGGGACGACTCGGACGACGAGTCGGTCGATGGCCGTACGCACA
AGCTGCCGCTGCCGTCGCGGTCCGCGTCGCTTGGCATGGTTCCGCGTGTGATGGCTAGCGAGGCGGGATGGGCGGCGTCGCCCTCGCGCGCCTCGACGTC
TTCCCTGCTGCCGCGCTGGACCAAGGAGACGCGCTGCTCCGAATGCTCGTGCTCCTTCGGGCTGCTCGTGCGCCGCCACCACTGCCGCGCGTGCGGCCGC
TCGTTCTGCTACGAGCACTCGACGCGCAAGCTGCGGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGCGACGCGTGCTTCGAGGTG
CATCTGCTCGGCGGCTTCGCGGTCGGCGGCGACGGGTACAGCCTCGGCACTGGCGCCGGGTCTGCTCTCCGGCGCGGCCGCAGCGACAGTCTGGCGATGC
CGTCTCCGCGGCCGCTCTGCCTCGTGGCGCGCTGCGAGGATGTGGGGTCCTTCTGA