Transcript Name :
Pytve_DAOMBR484maker-pve_contig_235-fgenesh-gene-0.8
Orientation:
(-)
Number of Exons:
1
Description :
NUC156 family protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-621
*** None ***
PositionContextScore
52LGFRPRR|GV0.72
*** None ***
GO
*** None ***
*** None ***
Cluster Id
3673
Sequence
        1866 bases(100 bases per row)
ATGGCGAGCACCAACCGGTTCCGAGCGCTCAGCTCGCCCTCCGGCAACGTCGTCGCGCTCGGCGCGCAGCTCGACACGGCCGTCAACTGCGCCGGCCAGG
CGCTCGTGCGCGTATACCGCGGGGACGCGGAGGTGCTGGGCTTCCGCCCGCGGCGCGGCGTCTACTACTCGCTGCACTCGCCAAAATGGGGAAACCTGCT
GGTGCTGCGGACGCTCGGACCCAATGATACGGCATCGACAGGCGGCGGCGCCGGAGTCGCGCCGTTCTCTGAGGCGAGTGCCGAGCTGCTGTCGCTCATG
GAGCCGACGATCACATTGAGCGAGCAGGAGCTGGAGACGGAGGAGTCGGCGGCGGACGACCTGGCGGCCGAGCTCGCCGACGCCTTCCCCGTCGTGCTGG
TCTTCCGCGCCATCCCGGTCACGTTCGGCAACGTCATGAGCTTCTTCGAGGGCTCGCGGCCGGACGCCAGCGGCCAGCACGAGCTGGTGCTGCCGGGCTT
CAAGATGGTCGTGCCCAAGTACAGCCAGACGGACCTGCGCGAGGCCACGGCCGGTTGGGACGCCGTTGCTCCTCCTCCCCCATCGGCATCTCGCGCTGCC
AGCCACGACTGGAAGTCGCCCGAGCGTGTGCTGGCCGAGTTCGCGGTCGTGGACGCGCTGCGCGTCGTGCAGATCACTGACCCGTGGCGGACGGCGGCGG
ATGCGCTGGAGTCGAGCCTGGTGGACGGGACGGCCAGCCGCATCGTCGTGTGCGGCGCCAAGGGCGTGGGCAAGTCGACCTTCTGCCGCTACCTGCTCAA
CCGCCTGCTGGTCCAGTTTCCGGTTGTGGCGTTCCTCGACACGGATCTGGGCCAGTCGGAGCTCACGCCGCCGGGGATGGTATCACTGCACGCGCTTGCG
ACGCCGCTGCTCGGGCCGGGCTTCTCGCACATGCGCACTCCGGTTCGCGCGTTCTTCTGCGGCGGCGCCAACCCCGGGAACGACCCGCTGTTCTACATGG
AGGCCGTCAAGAGCCTGCTGCGGCTGTACGGCGCGCGGTACGCGGCCAGCGAGCAGCCGATCCCGCTCATCGTCAACACGGACGGCTGGATCAAGAGCAT
GGGCCACGACCTGCTGTGCAGCGTCATCCAGGAGGCCGCGCCGGACCACGTCGTGCAGCTGCTGGCCGCCACCAAGAGCAAGCAGTTCGACGTGCCTAGT
GGCGGCGAGTGGCGCGTGCACCGTGTCGAACCGTGGGACCCGACGGGAACGGCCCAGTCGGCGCGCAGCTCCAAGGACATGCGGCTCTACCGGCTGCACA
CGTACTTCCTCTCGCGCAGTGCGTGGGACCTGCCGCGAGCCCAGCTGCAGAACCTGCACGTGCTCTCCGAGAAGAACCGCGTGGACGGCGAGATCGCGCG
CGCGTACGCCGGGCTCACGCCGTTCGCCGTGTCGTTCGACCAGGTGGACGTTGCGTTCGCCGGCTCGTCGGTGCCTCCCAGTCAGCTGCTCTTCTCGCTC
AACGCCAGTCTGGTCGGGCTGTGCGTTAATGTGGACCGCGCTCCGCACTCGCCGAGCGATGGACCGCCACGGATCGTGCTCGGGCCGGTGCAGGCGCCGT
GTCTCGGCGTTGGGATCGTGCGGGCGATCGATATCGAGCGCCGAGTGCTCTTCGTCGTGACTCCGCTGCCGATCGCCGTGCTGCAGCGCGTCAACCTGCT
CGTGCGCAGCACCATCCCTCTAGACGCGCTGATGGTGTCGGCAGTCGACCCGGCGCTCTCGCCGTATGTCGTGACGGATGTGGTGGCGTCCAAGGGCACC
GGGTCGGCGGCCATGCAGAGCCGCAACAACCTCAAGCGCAAGCGCGACGGACCTGGGCCAAAGTAG