Transcript Name :
Phyag_g39
Orientation:
(-)
Number of Exons:
8
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Pleckstrin homology domain12.053PS50003
Vacuolar sorting protein 910.464PS51205
Ankyrin repeat11.701PS50088
Ankyrin repeat-containing domain53.24PS50297
Ankyrin repeat10.873PS50088
Ankyrin repeat10.766PS50088
Ankyrin repeat13.01PS50088
Guanine-nucleotide dissociation stimulator CDC2516.891PS50009
HmmSmart predictionP-Valprediction_id
Pleckstrin homology domain7.2SM00233
Ankyrin repeat3100SM00248
Ankyrin repeat0.0039SM00248
Ankyrin repeat190SM00248
Ankyrin repeat0.94SM00248
Ankyrin repeat0.0017SM00248
Ankyrin repeat0.0068SM00248
Ankyrin repeat730SM00248
Guanine-nucleotide dissociation stimulator CDC252.2SM00147
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Vacuolar sorting protein 9IPR003123
Pleckstrin homology domainIPR001849
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-1348
NN-scoreoddsWeighted Score
0.5631.8980.004
*** None ***
TypeScore
endoplasmic reticulum348
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
guanyl-nucleotide exchange factor activityGO:0005085IEA
intracellularGO:0005622IEA
small GTPase mediated signal transductionGO:0007264IEA
*** None ***
*** None ***
Sequence
        4725 bases(100 bases per row)
ATGGCTTCAGGCTGGAAGTCCAAGACTttgacgctggagcagtggGACcctccgtcgccacctccactcCTAGACGCGAGCGCacccaagcccaagaagc
ggtCGCACTTCTCACGTCGCAGCACTCGCGCCAAGagccaagcgcagcagcaggcgcaaCATTTAGAGCTGGAAGTGGAAGAGCAGGCTGAAGAACGGGA
CCGAGACCGGCGCCGCAGTCTCTTGGCCGCTATGTTTGGAGGCCGCAGCTTGTCGCGTGCGTCGCGCTCGTCATCAGACGCCACTGAGCAGCCGCAGACG
CTCGTTCAGCGCGAAAAGGGCTTCCGATTGGTGCGTCACGGCTCCGATccgctgctgaacgactcGTTCTACGCCACGCAGATGCAAGTGGGCAACTTTG
TGAAGATGGGGTGGCTTACGAAACAGGGCCACatgtggaagagctggaagacgcgcttcttcgtgctgtttTCGGACGGGACGTTTGCCTATTACAAGAA
CAAGGGCCGGAAGAAGATCAAAGGCTGCATGCAGCTCAATGACGGCGTCGTGTCGGTGCAACATGTGGATGTGAAAATTGCGGAGAAGGCGTACGTGTTC
CAGATCGAAAAGGGGTTTTATAGGCTGCTGTGCTATTGCTGCAGTCAATTTGAAGCGGAGCTGTGGGTGGCAGCGTTGCGCTCGGTTAGGCGAGTCGCTC
CACCGTGTTATGAGATGCATCTGACGGCCAATGAGGAGAAGGCGGGATCCAATGCTGTTACGAGACACTTGAACAAGATCTTTATTACGGACAAAGAGAT
CGCCAAGATGTTGGTGGATTTCAAAGAGAACGAGCATGATCATTCGTACTCGTCGATTCACAATTTCATTGTGGAGTTGGATGACTCGATCATTGATCGT
CATCATCTGGAATTTTACCAGGACCCGGAGATTGAGTTGTTGCCCGGAAATGAACTGGTGCGGCTTATTCGGAGACATGTGGAAGATCGGGTGTTTATTC
CGTTGTACGCAGAGGCCTACGCAAGTTTAGAGAccgacaagatgaagagtaGACGCGACAATCTGGAGAAGAATCGTAAGGTGTTAAAGCAGAAAACGCA
GGCGGACTTTGGAGTGACAAAGGATTTGTCGATTTGCAACTGGAAGCAGGCTATCAGTGTGATCAATATGCTTGACTGCGTGTCGCTCCCGACGCATAAG
TTTGAGGTCATTTTATCAGCTGCAAAGGCTATCACGGAGGAAATCGCTCAATTTAACGGCGAGCTGTTTGAGGTATCGGACGAGTCATTAACAGCGGTGT
TCCGGTATGTGGTTACGATGTCATCGCTGAGTGACCTGTTAACTCTGCGTGCGCTACTGAAGTATGGATACCAGCACCATCCAGCATGCCAAAACAAAGC
AAACATCGTAACAGCTTTTCTCGATGCGATCAAATGGGTAGAGTGCTTTGAGACTGGAGATGAAAGCTACCGGTTTGACTCCATGGCGCTTGCAGGATCT
CGCGTTTCAGTGTCCATTTCGACCAACGATGTTGGCATTCAGTTCACAACGGATGGAAATGGCCGAGGAGCTATCGTGTACAGTGTTCGAAAGCTGTCTC
AAGCGGCATTgagcgctgccatcgtccCTGGACTTTCGTTAATTGCGATTAACCACGAGCCCGTGATTGGTATGCCTTTCGACAAGATCATTCAGCGTGT
CCGGACTGCAACATTACCGAAGCAACTCACCTTTATGACGGAGTTTTACTACTATCAGCTGTTGTCGTTGGACGCGGGGATGTTTCGGTATCTGATGTGC
ATTGCCGCTCGCCGTGGAGACCTGGATTCAGCTGCTTGGTTGCGTTCATCAACTGTGGAACTCAATACACTCTGTTCATGGGAAAAATCGCGGGGAAAGC
AAGTTTTCGGGTTTATCCCTGTATCCGGCAAAGGGTCTCCGCTTCACGCCGCAGTGCACAACGGACAACTCGGTATGGTCAACTACCTTGTTTCGAAGGG
GGTAGACGTCAACCTGTGCAACCATAAAGGGAGACGGCCACTGCATGTCGTGAAGCAGTCGATTGACATGGCGCAGATTATTCAGAGTCTGATTGACGCA
GGGGCAGACATTGATGCGACAGAGAAGTACGGACTTACTCCGTTAATGTTTATGTGCTCTAGGGGGTCTCTTGAAGGCTCagcgacgctgctggcgcttg
gAGCAGATGTCCACTGCGTTGCGTGGTCGAATGGCTTCTCGGCACTGGAGTTCGCAGTCAAAAGCGGGCGTACAGAGTTGGTGGAACTGTGTCTTTCGAA
GGGGGCAAATCCGAACGCGTCTACGTTGGATGGAAATACTAGTCTGCACTTGGCTGCCACCTTAGCACACACTGATATCATTCTCCGGCTCCTGCAGAGT
GGCGCAAACCCCAACGGTCAGAACCGGTATGGTCAGACCCCAGCGACAGttctgctggtggctgcTCCCGGCGGAAATGATGACGCCCGAATCTTGTGCC
TGGAGGTTTTGACATGTGCCGGCTGTCGCCTAGACAAACGTGATCTGTTTGGTCGACAGGCTGCGCATCTAGCAAACATTTCACGAAATATGCATGTCGT
CGGACTACTGCGAAAGTTGGGATCACTGAATCGCGCAAGTAATGACGTCGATGTGGACATCTTCGGCTGTACTTCTGTTGATTACACCCATCGCATCGAG
GTAAACAAGGCTGCAGGATATTTGGGTTCGCTAATGCCTGACAACTCGTGGAAGATCGAGGACAAGATTGACCACGCCGCTCGACCCGCACGTTCAAGTT
CTGTTGAGAAGTTGATTCGCGATCTGGTTTCTGGCCTGGAAGTGGACTTGGTAGACATACTGGCTTTCGTATTGTTTCTCGACAACTTTTCGAGCCTGAA
CGAAGTTGTGGATCGACTGAGTGAACACGTCCGGAATGGGTTAAAAGGTATGGTCCCGAAATGTAGGACTCATTTCGAGTTCAAATTTCTGACCGTGTGT
CTGTTATGTTGTATAGGTCACGGACTTATCCGTCTCTTCatcatggtgctgctgtttagACAATCAGAAACAAGGGACGACCTGCGTGAGCGTTTCTACA
GCCTCATCAGTCAGAATATTGACGTCCAAAAGGAAAAGCTGGTGCCTCTCATTGAAGAGTACACTTCACTTTACGGAGGGTATTTTTCGTTGCGAGGAGC
TGGGAACTACTCCGTGAACTACGAAGCGATTCCTGAAATGATGGTCAAGGCGTACGGATTAGAGTCGGGCTTTAACCCCGAATCTACCGAGGCTTTCCCG
ATTCATTTGCACCGGTAAACAGCATGATGGTCAAGTTCACTTGATTAACTACATCTGACCTATGATTTTTGGGGGTTGTTTGCGTGGGATTTAGGTACAT
TGATGCAGAGAGGTGGGCGGTGCAATGCACTCTTTTGACGCACGCGGTCTTTTGCGAGATTTCAGGTGAGACACAAAGCGTCCGCCTGATATTGAGAATG
GAGCTGATATTTTTTTGTATTATCGTCTGTACTGTAGTCCAAGATTTTATATCGTGTGGCTCGAAAAAGAACCATTCCACTGAGTTCACGACCATCAAAC
GATGGTTTCAACACGTACGTGCTAGCTATATACACGTGGGTGAGCTGATGATGTCTGGTAACGAACAGTGTGTTCTGGATTGTGTAGATTTCTGCCTACG
TGATCAACGCGGTTCTTGTCCAAAATACCCCGGAAGAACGCGCAGAAGTTATCTCGTTTTACCTCCAGGCAAGATGGTGTATGGGGTCGCTTCAACATTG
ATGCTGAGTACTAACCCGTAGTACTCTTGTGTATTCAGGTCGCCGATTATTGCATGTCATTACACAACCACGATACGCTGGCTTCCATTTTATACGCATT
GCAATCTACAGCAGTGCAACGCTTACGCAAGACAATCGACTGTGTACGTTTGCGGATGACGAACTCGATGGTGTTTCATGGAAGTGATAAAAATTAATGA
CTTTCTTGTGTGCTCGGTTTGCATAACTGCAGCTAAGCGTGgatgcgaagaagaaaatgaacGAGATGCAACTCCTATCGGACAAGGGCTGTCGCGAAAT
GAATCGGTTGATGCGCAAAACTTCCAACCCAAGCATGCCTTACATCGGATTGTACCTCCAGGTAGGCGCACGATgctttttgtttttcttcatTACCTTG
CGACGACAAAAGGCTAACTGGTGGTGTGTTTTTAGGGTTTCGTCGGGTTGAACGAGCTGCCTGCTTTTGACAAGGAGGGCCTGGTGAATACGAGTCGGCT
AAGAAGAATGGGGGAGCTGGCGATGGAAATTTTGCATCGCCAGTCTATTGCCTACACTCAGCAGAACGACAAGGATGTTGACGTGAGTTACTGTCGTCAT
GAATTCAGCATACCTAGACCCGTGGCTAACTTTTGTATGCTTCAATATGTAGAAATTGTTGCACGTCTCACTGCCGTACCCTTCGGAAGAGAGTCGGTAT
ACTCGTTCATTGGAACTGGAGCCGCGTGAGGCAGATGCTATGCCATTGAGTGATCGTAGTTCCTGTGTCGTCGTGGCCGATGATGACCTCGACCTCGAAA
GTGAAGTCCGTGGGTCAATCGGGGGTGACGGGAAATTTGGGTTTCGTCAGTGGATtcggaagcagcaggtaGTCCACCGGAACCGCTCACGTTCATCGGT
GATTGCTTTGTATGAGTGGGTGTAG