Transcript Name :
Phyag_g10
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_309032
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
F-box domain9.1PS50181
Peptidase C19, ubiquitin-specific peptidase, DUSP domain8.566PS51283
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-352
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
obsolete ubiquitin thiolesterase activityGO:0004221IEA
*** None ***
*** None ***
Sequence
        1059 bases(100 bases per row)
ATGGACCACCTGCCGGACGGTCTGCTCGCGCAcctcttctccttgctcTCGGCCAAGGACGTGCTCCAGCTCACCTCTACCTGCCGAGCTCTCTCTGTAC
CCACTCACTCCGTCCAACTGGCCTTGGAGCGCGTCATCACCCGCCACTTCGGCGACGTCACGAGCTTCCTGCCTTCCGCCTCCGACCACTGGCCCCGCTC
GCTCGCCGTCTTGCGCGGTGCCGAGTTGCTTCGCATCAAGGAGCTTCTGTCCCGTTCTTCCACTCACTCCTACGAAAGCGCCGCCGAGTGTTCGCccagc
tgcgtcgtcgtgagTCGTGCGTGGCTTGGGGCGTACAAGAAGCGCTGCCAAGCGTTTGAGCAGTTTTTACAGCAATTCCGACGCTCGAAACGGCAGCAGA
GACGCCAAAATGCTGCTAAAAAGAAGGACGTGGTAGTGGCACAAGAGAAGCTTAAAATTGCCGCTAATTCGTCGCTCACAGAGGCCGGCGCGCTGATCGT
GTGCTCCCATGGCGCACTACTCCCGGCTGTGCAGTGTGTGGGGAGAAATCGACGCGCCATCATCAGTGGAGAAGTCTTCAGGGAGATCTCAGTGTATGCC
CCAGAGTTGACGGGGTTCAATCTCAGATCCTGCTGTGACTGCCCCATGTgtgtgctggagcaggaggcacgggagctggagatcgaggagaaaAAGAGGG
CGAGGTTTGACGGCGAAATTGCAGGGTccgaagagctgctggagttaTTGCAGAGAAAAAATGGGTACCCGAAGGGATTATTCTCGCCCGTGGACTCGGT
GGgcagcagacagcagcaactggcgcCGCATTTGTCGGTGAATGGGAGGAGCAAGTACGCGACGTACTTCTTGGTGCCAAAGAAATGGCTCAACAAGTGG
AGGAAGTTTGTGCGCAGTCAAGGAAACGATGCTCCCGGACCGGTGTTAAATGCTGAATTGGTGTGTCTATCACACCAGAGGACTATTGTGCCGCCGTATA
TTTCGATGTTCTTGATGGGGTTCTCGCTGGAGCAGTCACTCAAGGCCACGCAAGCGTAA