Transcript Name :
Phyag_g12
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein PHYSODRAFT_321807
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.9030.92418
InsideOutsideTMhelix
204-215
281-286
343-362
412-443
1-180
239-257
310-319
386-388
181-203
216-238
258-280
287-309
320-342
363-385
389-411
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1527 bases(100 bases per row)
atgctgctgctagtgctCGTCCTCGTGGCGCTCTTGTCCCCAACACAAGGCAGCATCTACACGGGCTACACAGTGGGGCGGCAATTCCAATACATCGgca
agttctgcttctcctggaCGCCCAcactcgacgccgtcgcaGGGGTGAGATACAAcacaattttttttttttaccaaTTCCTAACATATAAACGTTCCCT
ATCAGCGTATCACCGGCGAGATTGAGACGTATGTGAACGGGCTTCAAGTTGCCatctacgacgacgaggagctcttCTGGGATTACGTCATGACCGACAA
TTCCTGCGACTGCTACTGCAAGGTCTCTCCGAAGCACACCAAGAGCGTCTTCAACGTTACAGCCACCAGTAGCCACCACGTGACCCCCTTTACCTTCAAT
GTGGACATTCACGAACATCTACGGCCAAGATTCTGGTACGTGGCGCTCGCGCGCTGCGTCCCGGGAGGAGACACGTACAAACCTTCGTTCGCAGAGATCA
CCGAGTCCAATTTCCGTAAATATTACTTCGCGTCGTGGTTCAATGTCCACATGACGCAGGCAGATGGCAGTGAACTGCCCGTTCAACAACATGGAATGCC
GACGATCTACGCAGTTATGACGGCTATCGggggagctgctgcagtggcgcaAAGTGTGGCAGTGCGGGGCATGAGAAGAAGCGAGTCATTCCATCCGATC
ATGAAGATTCtcacgctggtggtgctatTTTTCTTCCTGTGCAACGCGTTGCTCTTCGTTCATTTCAGCAGGTACCAGTTCAATGGGGTGGGCGTGCCAT
TCTTCAAGGTTGCGGCCAAGATCACCGACGTGTTTGTCAATGTGGGCACACTGTTGCTCGCCATGCTAATCGCGAAAGGATGGACAATCAACaatgtggc
gctggatggcCAGGTCAAGCTTTCGTGTGTCATACTGGCCATTCTCGCGCTTTACCTGTCCATGGCGATGTGGTATCTCGTTTGGCTTGATCCAGCGTCG
ACGCTGTACATTTACGATTCGTGGCCGGGGCTTGGTATCTGTGTGCTGCAAGTGTGCGTGCTAGGGTGGTTCATTAACGCCATTCTGGAGACACGCTCCT
ACGAGAAAGCTTCGACAAAGAGacacttcttcttgcgagTAAGTACAGACATGTGTCTACATTGTCTGGTTAACATGTTGCTCACCTCCGTTTAAGATGT
GCTGTCTGTTCTCGGTGTTTTTCGTAGCCTTGCCGATTATCGTGCTCATCGCATCCTTTTTGTCGCCGTGGGTGCGAGAGAAGACTGTTGCAGCTATGAC
GACCTCAGTGCACTGCTTTATCTATTTGACCCTCATTTATACATTGTGGCCAACCCGTGCACCCCGCTACTTCGAGGTACGGTAGCAGCAGAGTAGCATT
TGCATCGCTGTGCTGACAGTTTGTGTTGAATTGTTTTGTGACCTGCGTATAGCGCCTCTACTCGGTATCTTCACCGTCCGAGAAAGCGTCATTACGTGAC
CAGCATCTCCCCACTGAAGAACTCTGA