/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_5cacb6e73a9e15588af9a69f32813bca -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1642459 -w 120 -web -o /tmp/images/bd_log_output_file_5cacb6e73a9e15588af9a69f32813bca
Transcript Name :
Phyag_g2
Orientation:
(+)
Number of Exons:
11
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Protein phosphatase 2C (PP2C)-like domain6.5SM00332
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-949
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
catalytic activityGO:0003824IEA
KO ID
K00938
*** None ***
Sequence
        3800 bases(100 bases per row)
ATGGCAGGTCTCCTCTCCACGTGTGTGTCGGCGCCTGGCAAAGTGCTGCTTGTGGGTGGGTATGTGGTGCTAGACGATCAATACTCTGGACTCGTGTTGT
CCAGTACTGCGAGGTTTTACTCCCAAGTGGAGGCAAAGGTGAGATTGTATCAATTGTGTCAATTGAGATGCTGTTGAAAAAAACTAAGTTTTTTATTATC
ATCTATAGCAGCCTTGGGGCGGAGACGACTCGGCATCTGCTGTTTCAATTGATTGGCGTCGGCTGTTCCCATTGGCGGTGGAGAGTAAACAATTCGACCA
GGTGATTGAAGGTTGGGTCGAAGAGAATGAAGCAGGGAGGCTCCGGTTCCAGCTCAGGTGACGATGGAGTGCACAGTTTCACTGCAGTGGGGCTATTTTC
TAACATTGGAGAAATGTGGGGACAGGGAGGACTCGCACCGGAATTCGTACATtgaggagacgctgctgtgtGCAGTGAATGGAATTGCTGGattggacga
gttcaagatAAATGATACATTCAGGAAACTAtcggagacgaagacgcgtGTGCATGTCACGCTTCGGGGTGACAATGATTTCTACTCGCAAGTACAGAGG
GTAACAAGACCTTAGATTATTGTGGTTGGATTCAATGCTGACATTTTTATTTTAATGCTGCATTAGTTGCAAAATGCCAAGCTGCCACTTCGTCGCGCAA
ACTTGAAGACACTTGAGGAGTTTCTCCCTCCTACAATGGAAGGTAGAGGTGGCATTTTTTTATTGTGTTGTGGAAAACTCTCTGATTGTTGTGTAGAGTG
TGGTGGCAAATTGGTTGCGTTGAAGACAGGGATGGGGAGCTCTGCCGCTCTCGTGACGTCGCTTGTGGCGGCTCTGGTGGCTTTCTTTGTGCCTACGATG
AGCttcgacaagcagcagaaggaccTAGAGCTGGTGCACAATTTGGCCCAGCTGAGCCACTGCTACGTGCAACGCAAGGTGCGCTTTGTCGCTGCATGTA
ACGATCGAATGGCCCAGTAACATTTTGTTGCATTTACTGAACTACAGATCGGAAGTGGCTTCGATGTCTCTGCGGCGTGTTTCGGATCACAGCGGTATAC
CCGTTTCCCAGCGACAATTTTGAACGCATTTACATCCGAAGACGCAATGGCCCCAGAGGAGATTGCGAGCTGCATTACAGACAGCGCGCTGTGGAACAAT
GCTAGCCGCGTGGTAAAGCCAACTTCTCAATCTTTGTATTACAAGGGCTGTCGCTCTAACTGGTATTTTGTCGATGTTGATAGAAGTCCGTTCGGTTGCC
TTCATCTTTCCACTTGATGATGGGAGACGTGTCGTCCGGCTCGGCGACAGTGTCGATGGTTCGGCAGATGCTGAAGTGGCAAAAGGAGCAGCCTGAACAG
GCCAAAAGAGTGATGGATGCAATTCATCGTTACAATTTGGAGGTCGAGCAAGGGTTTGCTGACATCTGCGAGTTGGAAGCTAGTCACAGCAACCCCATTG
ACTGGGAAGCGTTGGCAGCGCAAGGCCGCGAGCAGGTAATTCTCCTGTGATCCTCTTTAGTTCTTCTTTGACGAGCTCACCACTGTTTTGTTACTTGTGC
GTGCAGTGGAGTACTATGGATGCTAAGATTGGGGCCATGCTTCTGCGAATCAGCGACGCGTTCTCTCATTTCCGAAGCTTGATGCGGTAAACTTACTTGA
TCATCCAACAGATTCCTTGCGATGGGAGTCTGATAATACGTGTGCTCTTTGTCATCATAGTGAAATGGGAAATTCCGCTAGAGTCCCAATTGAGCCGCCG
GAGCAGACAACTATCCTCGATGCAACGCTGGCGATTCCCGGTgttcttctcgctggagTACCTGGAGGTACGCTCTTCAATTGAGTTGAGCTTGGTGCGT
GCTTTTATGCTGACAACAGCTTGTTACTGTCTTCAGCGGGTGGATACGACGCGATTTGCGTGATCGTGATTCATGAACGTGCTCTCGAAGCGGTTGAAGA
CCTGTGGATACAGTGGCCTACTACTCACCCTGACTCCATGTATGCCTCTCAAACAATGCACGCATTGTGTATACATAATATCTGACGGTGATGTGTGTTG
TGTTGTCTCCTGAAGCATTTGCCCGTTGATGTGCGACATCGACCGTGGCTTGACGGGTTCTTCGGCTGTGAAATCTGGGCTTCAACTTCACCCCGTTGAG
TAGTTTTGTGCTTACCATCGTTCATCCATGTGGTATGGAACTAGACTAACACGTACCTTAGTGCATAgagtccaagtcgtcgttAAATGCCCGAAAGAGG
GCGACGCATAACCAAAATCTTTGCCTTCAATCTTCCGCCAGGGGTCACGAGTCGAGTATGCAGAATCTGTCAAAGCGGAAGGTCCGTGATGAGGGTGACA
TTGAGGAAGGAAGAATGCTGAAAGCAAATCACCTGTTGCGTAGCGAGGAAAAAGCTGCGCAAGCGAAGATGTTAGAGCAGGACCAGCATGGAGAGTTCTC
AATTCCTGGACTTCGGTTTGCGACTGAGTCGTGGGCTGGTCTGAAGACAAGCAATGAGGATCGCCACGCTTCCTCCGTTGAGTTATTTCCTGGACCTGTG
CTTGGCATTTTTGACGGCCATGGAGGAACGTTTTCGGCGGACTTTTTGTCCCGGCAGCTAGTGAAGACTGTCTCCTCAACGATATGTCAAAATGTTGGAG
GAATAGTGCTCGCTGATCTGCAACGTTCTCGATATCTTTCGAGCCAAGAGAACACCCGCAAGAATGCTATTATGGAACAAGTTTCATTgctgcgccagca
gcttgcagaGCTCGAAGCCATGCAACCAGACTCCGAGATTCGTAAACCAGATAATATTGCGGACGCTTCCGATGAAGTGGATACTCTGCTCTCGGATGCC
ATATCGCAATTGGACGGTGAGTTAGGCCAAATCGGTGTCGAGGAAGCAGCGCGACGAGTGAGGCGAAAGAAGTGGTGTTATGAAGAGCACAAAAAAATTG
TGACTGCATTCAAGGATGCCTTTGAGCGAGTCGATTCACAAATCTTGCAGAAAAACCCGTCGCAGGATGGCTCGACAGCTCTTTTGGTTTGGTTCTTAGC
GGATACGCTTAGCATTTGCGACGAAATGGGCACCAAGAATGACACTGCAGACAATGAACAACAAGCGGGCGAGCTGAGCTTCTATACGGCGAATGTTGGT
GACTGTCGTGCCGTTATGTGTCGTGGCGGTCGGGGTGATCCGCTCACTAGTGACCACAAACCCGATCGCCCCGACGAAAAGCAGCGAATCGAAAAAGCTG
GCGGTTTTGTGGGGAAGATTGCAGGCATATCTCGAGTATACTCTGCGGCGGGTGCTGGGTTGGCCATGCAACGTGAAGCGTCTACGTATCTGGCTGTGTC
TCGTGCATTTGGCGACCGATCTTTGAAAACCCCAACGCCACTCGTTTCGTGTGAGCCAGAAGTAAAGCGGTTCACAGTGCAAGCGGATGACTTGTTTCTC
GTATTGGCCTGCGATGGAGTCTGGGACGTACTAAACGAGCAAGATGCCGTGGATATCGCTCTACCACATTTCCACGATGCAAAAGCTGCCGCTGAGGCGA
TCGTCAAGGCTGCCTACAGGAAAGGGAGTGTTGATAACCTGACAGCCACGGTCGTTCAGTTCGGCTGGAAGTCCGATGCACAGGTTCAGCAGGCTCACGA
GCGCACCAAGGCGTCCAAACCAAGTATTCCGAAAGGGAAAAACGCCATTGGAGCTGTCGATGATGGTTCTGAAGAGGAGATCGACATGTTCAACCTGTGA