Transcript Name :
Phyag_g20
Orientation:
(+)
Number of Exons:
1
Description :
copper-transporting ATPase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Major facilitator superfamily domain1PR00943
Major facilitator superfamily domain1PR00943
Cation-transporting P-type ATPase6.4PR00119
Major facilitator superfamily domain1PR00943
Major facilitator superfamily domain1PR00943
Cation-transporting P-type ATPase6.4PR00119
Cation-transporting P-type ATPase6.4PR00119
Cation-transporting P-type ATPase6.4PR00119
Major facilitator superfamily domain1PR00943
Cation-transporting P-type ATPase6.4PR00119
Cation-transporting P-type ATPase6.4PR00119
Major facilitator superfamily domain1PR00943
Profile scan predictionP-Valprediction_id
Heavy metal-associated domain, HMA18.564PS50846
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-464
526-545
623-757
818-1125
1175-1204
488-506
569-604
781-794
1149-1151
465-487
507-525
546-568
605-622
758-780
795-817
1126-1148
1152-1174
NN-scoreoddsWeighted Score
0.5571.8010.004
*** None ***
TypeScore
endoplasmic reticulum667
GO
Biological ProcessGO IDPrediction Method
metal ion bindingGO:0046872IEA
integral component of membraneGO:0016021IEA
metal ion transportGO:0030001IEA
cation transportGO:0006812IEA
*** None ***
*** None ***
Sequence
        3615 bases(100 bases per row)
ATGGGCAAGCGCAAGAATCGCCGCGCGACGGCCGCAGCCACCGCTCTGTCCGATCCCGCGActgcagagcaagaagagaCGGTGGATTCCTCCAGCGCTG
GTGACTGCGGCGGCGTCAAGAGCGACGGAAACGAGACTGCAGTGTCATGCTCcagcggcgaagaagaaggcgacggaACAGACGAGACGCAAGACGAGGA
gagtgaagctgctgctgctgctggctcgGGCTGTTGCTCGTCGAAGGCTAAAGAGACGGCGGATGACTGTTGCTCctccaagaagcaggaggctAAGGGA
TGCAGCTCTACTGAAGCTGCTAAAGCGTCCAATGGGTCAGGCTGTTGCTCGTCAAAAACTGCAGAGATTGCAGACAAGGCGGAGAAGGGCTGTGCTGCCA
AGGAAACGCCCATTAAAGCGTCTGGTTGCTGCTCATCAACGGCTCCAGAGACTTCAGGCGACGGTGGCTacttctcgtccaagaagtcgacgaaTAAGAA
CAAAGCTGAGGGAGGTTGTGAGCCCAAGAcatcgagttgctgctcgtcgaagGCTCTGGAGGTTGTTAGCGAGGCGGGTGGGTGTTGCTCTAAGGAAAAG
AAGACGTTAACTTCTGGTTGCTCCTCGAAGGGGTCCAATGTTGACGCTAAACGTGACGATTGCTGTGCTTCCAAGAAGGAGCCGAAGAAATCTGGAGGCT
GCTGttcgtccaagaagaaagagtCTGGTTCGGGATGTTGCTCGTCGAATGCACAGGAATTGCCGGGTCCAGAGCGATCAGCCAGCTTTTTGAATCGTTT
GATGCAGTTCCGCAATGACCGTGGGGCTACACTTGAGAACCATCGGTCAAGTCTAGACCGTTCgggaaagaagaagaaaaagacaaCCGAGTTGGAGATC
CTCCGCCTGAATATCGGTGGGATGAcgtgcagcggctgctgtaCTCGTATTGAAAAGTTCATGATCACGCAGCGTGGTGTTACGGACGTGAACGTGAGTC
TACTTACGAGTCGCGGTATCTTCCGATTTGACCCAAAAGTGGTGACGGCGAAACACATTGAGGAAACTGTGTCAACTATGGGTTTTGAACCCAGTGTACT
GTCCAGTGATGCGCTTGTAAGTATCGTGCTGCACCTTGGTCAGGCGAAGAGTATTCCACAAGCAAAACAATTGGCTCTCCAGATCGACGGTGTTGCAATG
GCTGAACGAGTTGATAAGCGTTTCTCGGGTTCCTCATATGAGGCATTGCTGGTTACATACAACCCGGATGTCACGGGTGCTCGTAGAATTGTGTGTCAAC
TGTCGAGCGAGCTCGGACTATCTATTCAAGCATCGAGTCCGCAGGCACCATCGGTCCGCGCTGGCGAAGACGAAGTGCGACGATTTACTCGGCTTTTGTT
CTGGAGCTGTCTTCTGTCTCTTCCTGTCATCATCGTGGAATTTCTGTTGCCGGTGTTCTTTCCCTTCTCCGGTGACAATCCAGCTGATGCTGCACTCTGG
GGCACTGCGAACCGTGTGAGTATCAGAGCTGCTGTGGAAATGGCGTGTGCGACGCCAGTGCTGTTCATCGTGGCTCGACCCATCCACGAGAGTGCCTTCC
TCTCGTTGCGGTACGGCGGCCGAGTTTCCATGGATGTTCTCGTCTCGCTAAGTGGCTGCACAGCCTACGCCTTTTCTGTTTTCACTGTGGTCACTGAGGC
ACTTGCGAAATCTCGAACACTGGAAGTAGTGCCAGCTCAAGTGGATCCTTCAACGGGGTCGACCTTACCCCCAGCTCTAGAACAAGTGGAGACGCAAGCC
AAAGCAGAAACTTTTTTCCAAGTCACAGTACTACTCATTACTCTCATCCTCGTTGGACGCTACATCGAAACGTTGGTAAAGGCACGCGCCTCAAACAGTG
TGGATGCATTGCTGCGAATGCAGGCCAAGACCGCAATTTTGCTCGAACATGAGGATGAGAAAGAATTGTATATCGATGTGGTGCTTGTGGAACGTGGCGA
CCTACTTAAAGTTCTCCCTGGTACGCGGGTGCCTACGGACGGTGTGGTTGTCAGAGGTGCTAGCTCTGTGGATGAGTCCATGGTAACGGGTGAAGTCCGC
AAGGTGCCTAAGGAAGCTGGAGCAATTGTGATCGGTGGGTCCATAAACTCACAGGGTGTATTGACCATGCGAGTAACACATACCATTCACGAATCGATGT
TGGCGCGCATGGTGCGGCTTGTGCGGGAGGCCCAGGCTTCTCGCGGTGTGCGCCAGAGCATTGCGGATGCTGTGGCTGCTTACTTCACCACGTTTATCAT
CATTCTGGCTGGCGTCATGTTCATGTTCTGGTACTCGCTGGCAAAACACGGTCGTGTGGATACACAAGGGTGGGCTCCATTCCCGTTTGCGCTGCGCTTT
GCGATAACAGTGCTAGTTATTAGTTGTCCATGCGCGATTAGTCTGGCAGTGCCTACTGCAGTGATGGTGGCGACGACAAAAGGCTCGCAGGTGGGTATTC
TTTTCAAGGGCGGTCGTGCgttggaggcgctggaggaagtGGATGCTGTCGTGTTCGACAAGACGGGCACGCTCACCACTGCGCAACTTGGTATAGCTAA
TGTCTTCACGCCTCAAATCGGATTCGACGAAGCACAACTCTGGCGTTATATAGCTGCCGCCGAGAGCGGCAGCGAGCACTCCATCGGCAAAACTCTCGTG
GCGCATGCTGAGACTCAAATAGCAGATTTTCGGGTCGATCAACCGCAGTGTTTCGAGGCTGTTCCAGGTTGTGGGGTGCACTGCGCTGTGGGCGGTGTTG
ATGTTCGACTCGGCTCGCTTACATGGCTGAAGGGGCAGACTTACGGCGAGTGTCGCGCTCTTAGGGTCCCTGCGGAGTTTACTGAAGCAAATCAGCGCTT
CCAGTCTCAAGGCTGTATTGTGGTGTTTGTTGTCATTGATGGCGAGTTGGTATCTGCCATTGCACTCCGAGATGCACCGCGTCCAGAAGCCAAACGTGTC
ATTGAACAGCTGAAGCGGGAGGACATTCAGCCATGGATTGTTACGGGTGATCAGCGTGGCACAGCAATGAGtgtggcgacggcgctggGCGTTCCAGAAG
GCTCTGTGTTGGCTGAGAGTTTGCCTCATCAAAAGGTGGATAAGGTACGCTTGCTGCAGAGTCTGGGTTTGCGGGTGGCATTTGTGGGAGACGGTATGAA
CGACGCGCCAGCGCTAGCCACAGCCAATATTGGTGTTGCGCTTGGGGCCGGTACTGATGTAGCGATCGATGCTGCCGACGTCGTTCTAGTCAAGAATGAC
CTGCGCGATCTACTCAATGCACGGGCACTTTCGCACGCAACCAACAAGCGCATCAAGCACAACTTTGCGTGGGGGTTTATGTACAATCTGCTCATGATGC
CGGTGGCGTGTGGGGCGTTGTATGCTCCACTTGGAATTTGGATTCCTCCAGCCGTTGCTGGTCTGTCGGAGTTATTGTCATCGGTGCCCGTGATTTTGTT
CTCCTTGTTGCTTAATCTTTGGAAACCTCGCTTCACTGGTGACTGgggccagcagcaacatcacgTAGTCATCGACGTGTCCGAGTCGACgcctctgctg
cagaagcaacgGTAA