/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_bb390c9c56f9eacd9e4d9d0398f613b1 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1642459 -w 120 -web -o /tmp/images/bd_log_output_file_bb390c9c56f9eacd9e4d9d0398f613b1
Transcript Name :
Phyag_g14
Orientation:
(+)
Number of Exons:
3
Description :
myosin-like protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Leucine-rich repeat, ribonuclease inhibitor subtype3.5SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype3.2SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype1.5SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype15SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype72SM00368
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Leucine-rich repeat, ribonuclease inhibitor subtypeIPR003590
*** None ***
InsideOutsideTMhelix
1-473
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1562 bases(100 bases per row)
ATGGCATTACTGATGCCCGACATCAATCTCCGTCGCGCCAAGCGCCACCTCGAGGTTTGTTCCAttgagcttctgcacgtcCTCGATCGGGCCTTACATG
ACGGTTATTGTCCCGCGTAGCGCTACTGGAGGCAATTGCTTGGCGGAGACCGAGCAGGAGAACGCTTGATATTTCGGTCCGTTGGCCAGGCCAAAGCTAC
TATCGAGAATGCGAAACCTGCtgaagtcgacgtcgctccaccacttcaaaATCTAGATCCCGACCCGGAAATGGAGAAGCCCACGGTAGCGGTTGTCGGT
GACTGCAATCGGAAGCCCGATGCTCGACTTGATTGCCGATCCTTATCAGTGGCGATCAATGCGAGCAGCAACCAGGACCAGGAAGACACCGAGAAGAATG
AGGCACATCGCGAACTGAATCAAGTCTCTATCATCTCGAGTGCTTCTGTCGGTAAGGCAGAGTGCAGTGGACCGCAGACGGAACTGCAGGCTGGTGGGAG
GGTAGTGGCGTCAAACGACAATTTGAAGCCGGGGTCGCAGCCAACTCCGTCGTCGACAAGCACTACTGGAACGTTGTCGACAGTGAGTTCTGTCGCTTCG
GTGACGTTCGGTTGTGAAGGAAAGCCGTCACCACCACTATCCATTCGACAAGTGTCTAACaacggccaagaaggcatGCTACCACCGACCCATACCTCTC
GTGTTCAAGGTCAATCGTGGTGAACTACTGCGTGCCCTTTAAATCCATGCTTACAATTTTTGTGCTTTGTACAGGTCCTACGCTGGGCTCTATTCTGCAG
CGGGTTCACCTCAATGACGGCAACGTGAGTGAGTTGGACTTCTCGACCCTCGCACAGCGCAACAAGCAATTGGGATCTGAAGGGTGTGCTCTTGTGGCTC
GCTCTCTATCAACCAACCACACCGTTCGAAAGCTCGTCATTCGAGACCATGCTATCGGAGACGATGGTGCCATAGCTCTCTCCAAGATGCTGTGCAACAA
CACAACTCTGGAATATCTAGACCTGTACGGCAATGAAATCGGTGTTCGCGGAGCTGAAGCATTGGCACAAGCACTGTATGGGCACGACTCATTGACACAC
TTGTGTCTTCGGAGCAACTTGATAACCGACCTCGGTGCTGAGGCTTTAGCTCAGGCTATTCGCTGCAATTGTACACTCAAGTctgtggagctcgtccaga
ACCGAATCACGAAAGTTGGGGCCCTGGCTCTGCTGGATGCATTGGACGTCAACCTGCATTTGGAGACGGTGAATTTGGAGTCAAACGATGTACCAGCGTT
TGTAACGAGTCAACTTGCGGCAGCACTCGCTCGCAATCGAGCCGAATCGTTGATCCTGGAGTCGCACgctgcggagaagaaggccgaAAAAATTGTGCGC
AGGGCCAGTGGGATGGAGAcccaagacgaagacgaggatgGCAGCAGTGAACTGGTGGATGAGGAGTGGGAAGATGACGACAGTGAAAGCGTGTCGAGTG
GTTTTCTGACTTGTTCAGGCGTCACCGACATCCCCCTTAGCAGTAGTGGTCTGTGGATTTGA