Transcript Name :
Phyag_g23
Orientation:
(+)
Number of Exons:
3
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Leucine-rich repeat, ribonuclease inhibitor subtype2.1SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype1.8SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype0.23SM00368
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Leucine-rich repeat, ribonuclease inhibitor subtypeIPR003590
*** None ***
InsideOutsideTMhelix
1-677
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2162 bases(100 bases per row)
ATGCGCGAATATCTCGACGAGGACtcggaggctgcagctcttgtgCACCCCAAacaagcagcttctgcctCGAAACCCGTTGGTGTCGTACTGGACTACA
GCAATTCGTACCTgggcgacgacaagttcgacGAAATCGTTGAAAGGGCTCGACTAGCGAGCGTCCCGACGCGGTTGGATCTGCGTGGTAATTGCTTCGA
AGCTGGGGCTGCACAAGCATTGGCAGCGTTGTTGCGATCTTCACACAACATAGTGGCCATCAGTCTGGAATGGAACAATGTTGGGCTGCTGGACCAAGGA
GTCGAAGCCCTGGCAGGTGCACTGGAAATCGACAAACGGTTGCTAACACTCGATTTGCGTAACAATAACATCGGACCCGAAGGCGCTAAGGCCCTCGCAA
TAGCTCTTCGCGTCAACCGCACACTTCGTCAATTGGACTTGCGCTGGAATGAGGTTGGGAATCCCGGTGTATTGGCATTTCGCGAGGCCTTGCAGAGCAA
CTACTCGCTCGTGACATTAGAGCTCACGGGAAACAATAGCAGCTTAAAACACGCGGATGAGATTGAGGCGCTACTAGCAAGGAATCGTGCGTTCGCCGAG
AGACCAGCGCCTTTGGCTGTTGATGCCTCTTGCCAGCcggatgacgatgatggaTCAAACCGCAAAAGCCCGAAAGCTGCTCCTGACGATCAACTACTAC
TACAAGTTCTGGCGGAGAAAGAAGAACTGGAGACTGCAGTGGACTTAGCCAAGCGAGAACGACAGAAAATGGTCAGAGTCCTACCGGTGGTGTGTAAGCT
ATCGAGGATTGACGTGTGTTGTTCATTTCTACCAGACagagaagacggaggagctcgagatgGAGTTGCAACAAGTTCGCAAGGATGCTGAGATGACgaa
agaagaacgagatcgCTACCAACAGCGCGAGACCGATGCAAAGCGCAATGTCCATGAGCTGAAAATGCAGCTCGATGAGCTCGAAAACCGAAGAAAGCTC
GAGTTTGAAGAGTACCGGTCTGCACGCACCGCTCTTGAGCACGAGAACGGCGTTGTTCGGGAGAAATGGGGGCAAACTGAAGCATTGCGAAGCAAGGAGG
CAGAACAAAAAGACAAGCAGATCTcgcagctggaagaggcCAAGTACGCACTCGACAACGAGATGCATCGCGCAACACTCACGATAAGGTAGGCTTGGGC
AGGTGGAATATTACTATTGTCACGGGGACTTAGTTGCTTTTCTGTTGAACAGGGCGCAAGGAGACGAGATTGGAAAGCTacagaagcagcttcaagatgc
TCAACAGGAGTTTGCGCGCAAAGAGGCCAAGCTGGTATCGGACCACGAAGCCACCTTGAGTGCAGCCCAGCGACAGCACGAAATGGTCGTTGGATCTGTA
CAAACGCAACTTAGCTACTCCTCCACACAGCTAGAGGCGAGCGAACGAAGCGTGCGAGAGCTAAAGGAGAAGTGCGAAGCTCTGCAGGCCAAACTCTTAC
AATCTCAAATCGACCATGAAAAGACAATAGGagagatgaagcagcagtgggaaACTGAGATTCAGGAGCGAATCCAGCGCTCAGTGGGATCAGTCGAAGC
CCAAGTGGccgaggtgaagaaggtgcgcCAACATCTCGAGCGGGAGGTGGAGAAACACCTCGAGACGAtcatccagctccgtcaGGACAACGTGTCGCTG
CAACAAGCGCGAGATGAACAACTGAGAGAGATGGAAACCGCAATAGAAGCGCAGTCCAAaacgctgcaggagaagcagacgcaattggctgcagcactgA
GTGAACGATCTCGCATCGAAGAgaaacttcagcaacagctgcggaagatgaaggaacAGGATGCTCGCCTTGTCCAGATGCAGGCTACCTACGATGAACG
GACCCAGGCCCTGATTACCAGCGCAAAGTCCGCGGCTGAGGAGAGTGCTAGCATTTTGAAGGAAAAGACGGCCGTGATCGCGACGCTAGAGAGCCAAGTG
CTGCGACTGGAACGAGAGTTGTCAATGCAGAATTACGAGCACGAGAAGCGCATCGACGACTTGGCCGAGTCCTTTGGCCGATTCGTGCAGGAGCAGATCG
GCAGGGAGCGAGAACGCCGAAAGAAACTGTCACTGTCAGAggcgtccagctccgacgacTAA