Transcript Name :
Phyag_g9
Orientation:
(+)
Number of Exons:
30
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Fibronectin, type III15.424PS50853
Fibronectin, type III10.154PS50853
Fibronectin, type III12.499PS50853
Fibronectin, type III17.842PS50853
Fibronectin, type III14.713PS50853
Fibronectin, type III13.33PS50853
Fibronectin, type III11.036PS50853
Fibronectin, type III10.432PS50853
Fibronectin, type III8.948PS50853
Fibronectin, type III13.722PS50853
Fibronectin, type III13.058PS50853
Fibronectin, type III6.596PS50853
HmmSmart predictionP-Valprediction_id
Fibronectin, type III6.6SM00060
Fibronectin, type III6.2SM00060
Fibronectin, type III3.5SM00060
Fibronectin, type III1.6SM00060
Fibronectin, type III1.3SM00060
Fibronectin, type III8.8SM00060
Fibronectin, type III0.12SM00060
Fibronectin, type III6SM00060
Fibronectin, type III5.4SM00060
Fibronectin, type III5.9SM00060
Parallel beta-helix repeat1300SM00710
Parallel beta-helix repeat1800SM00710
Parallel beta-helix repeat9000SM00710
Parallel beta-helix repeat4000SM00710
Parallel beta-helix repeat5300SM00710
Parallel beta-helix repeat1500SM00710
Parallel beta-helix repeat1800SM00710
Parallel beta-helix repeat1200SM00710
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Parallel beta-helix repeatIPR006626
*** None ***
InsideOutsideTMhelix
2816-2969
3155-3265
3316-3326
1-2792
2993-3131
3284-3292
3350-3440
2793-2815
2970-2992
3132-3154
3266-3283
3293-3315
3327-3349
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        26107 bases(100 bases per row)
ATGGATACGACGCTGTTCTCTACTGTGGGAAGACTTTTCATCAATAATGCACTTGCTCAGGTGAAGCCTTATAATTCTACTGCTTCGTTCATCGTCTTTG
ATGGAGatagtggtggtggacttTCGTTCACCCCATCTGAGTACGGATACTTTCTGGTCGATGTAATTTTGGAGTGGGAGAACGTAGACGACCCTGCCTC
TGGTTGCTTCTTTCTGCAGAATTTTGTGGTATCAGTGATGCCTTTATTTGCACCGCCAATCTTTGCTGCTCCATATGCTTACAGCAAAAAAGTTCTCGAA
GGCTCTACAGCTCAAATAACTATCCCGATACTGGCAGCCAGTCTTCCAGAGATCGAATACATTACTCTCGTCGTAACACTGAACATCACAGTTGATGGAA
TCGTCATCGAACGTGACGGTATCGAGTACAATCCTTCGCCAGGAGATGATCGCTATTTTATCCTCATCCAACGCGAAGATGATTTGGATAGTGCGAGACA
AGTTACCTTTTCGGTCACGCCAAACAGTAATTTTACAGGGGGCGTACGGTTTTTCTTTGCTGCCTCCGCGATCGGCTTGGTGGAAAATGTGACTAATTTT
ACAGACCTCGGGGTCGAATCATCTACAATACGCGAATTAGACGTCGAATGGATCTCGACTTCTAGTTCAGTAACTGGTCCAGCCGCATCGGGTGATGCCG
TGTACCGGAGCTTGCCCACAAAATTGCAAGGCGATTCAACACTTTCGTTCAAGTATCAAATGTCATCAGGTAAGGGAATATTTTCTTTCTAGCAATTGTC
CACGTTCTAACCGAAACATTTTTTGTGTGATTTCGTCAGATTTCTCGCGTGTCAGCACGGAAGTAATGCTAAATTCAAGCGAGACCAGACAAGTGTGGTC
TAGCGATTCTGCCGTTACTAGTCAAAGCGATTGGAATCATGTCGAAGCAGTGATTATCATCTCATACGCTTCAATTGCTGAAATTGTTTTTCGTGGCGTG
GTTGCGGTAGACGATGCACTATACTTGAAAGCAATCAAGATTCGCGACTACGTACAGGAGAGCATGGCAGGCGAGATTGAGTTTGTTCGTGCGACTGGCG
GTATGATTTACATCGAAGTCAACACCACAAAATCTATCCCAGACCCCATTCTGTTTCGGGTTTAtgtcaagaagacgaacaccACCGAGGCCCCAGACCT
CCGCGTCACTGGTAAGATCATTTAGTTCTAACGTTTGCCAGCAATGTGTTCTAATTTTTCGCCATCTAACGAATTAATTCCTCACCAAAGGTGACGGGCT
TCAGTATCTTGGTTGCAAGGATACCACGACAATGTATCCATGCACAGTCGGTTCGGGCATCACGTTCGAGAGCCCCAGTCAGTGCAGAAAGCCGTGTTCC
GCCGTTGAAACCCAAATTCAGTTTACCCCCGATTCGATTGTGAGAAGTGCGCAAATGATGTCTCTCTCAAGTATACAAATGACGCCGCTGCCGATCATCA
ATGCGTTTACGATTGAATTTTGGGTGTTTTTGGAAAGCCTGAGCTTCAATTCCAGTGATCAGCaacttttgctgctttttggTACCCTGGATGCGAGCCT
GAGCGTAACACTAAATCGTGATCTGCTGATATCTTGGTGTCAAAACCAGCTTCGTGTTCCCCATGGACTCCCACTGCAAACATGGGCACACCTGGCACTT
GTATTTGGCGCAACTAATGCGGTGACTGTATTGGTGAATGGAATCAAACTAGCTGAGGGCCTACTAAGCAAGGAAAATTGCCTGATGCCACCATACGCGT
ATCTTCAGCTTGGACGAGGCACGATCATAAAAAGTTTGTACTGATGCACAAGTTACTGACTTAGTTTTGTTACATTGCATTTGTTTTGTTGTAGATGCAT
TGAACATTCGACAGGAGACAACTGTGTTCCAAGGTGCTATGGACGAGGTACAGCTTTTAGATGTGCGCCATTTTATTCTTTTCCCTTTTCTCACATTCTA
TGTGTAAATTAGGTTCGCGTTTGGAGCGTGGCCAGAGATCCAGCAGATATCTATTCTTCGTTCCAGAAAAATATTGTCGATCCTACTTTGATTCTTGGTT
TAAACTTTAACTCTGCCGAGAAGACAAACTGGTTTCCGTCGGGGGCAGATGGGAGCGGCAACACCGTGGACTTTATGGCACAAGAAGTGAATACTATCAA
TACGCGGCCAATCCAATACcttggagttgctggagatggaagTTGCCACTACGAATTAGTTGCGTCTGCCGCCGAAATAGCTTCGGTGTCCTACACGTGC
GATAAGACATGCGGAGATGGAAGTATGAGAACTTGTGGGTCTACAACTATCAATAAGGTGGCTAGTGTCTATGGAAAAGGCCCTATCGGAGTTGGTGGGC
TTGATCCACTTACAGATTACGACATTTCGGTCGAATTTGTGACTGGAGACGGCGATGAATTTGAAATCACCAAGCCATTAATTGCTACCACCGCGAACGT
GACAGTTCCGGGGAAAGTGGAGTATATCGGTGTCGTGGAGCAGTCAGATCAGTTGGTTGAAGTCCAATGGAGCCCTGTCGATGATGATGGAGGGTCCGAA
ATCTTGAGCTATTATATCTTTTTGAACGAGGCAGAAGTAGTAAATACTGGAGATGGAACGACATTGTCAGCGACGTTAACTATCGCGGAATTCCAGGTTA
GCTATGAAATAACAGTACAGGCAGAAAATGCTCAGGGCGTGGGTCCTCAAAGTGACCCGCTAACTTTGACAAGTGTGTACAGTGATTCTACCCCAGAGGT
ACCACAACGCCCAACAGTGTCATTGGTATCTGGAGGAACGGTGGTGTTTGTGGTGGATGAAACAACCAGGTTGGCTGTTGCAGAGCGTTCGTCTGAGCTT
GTGATTGAGCAACGCGAGCCCTCTGTCACATTTTTCACGACAGCAGTGTATCAGCTCACTGACTCAGTCGCGACCGTGTACAAACTACGCCACAATACCG
TCTACATCTTTCGTCTGAGCGTGATCAGTAAATCTGGCGTGCAGAGTGGATATAGCGTCCCCATTTCAGTGATGACTGGAAGCAGAGGGAACCCAAGCAA
GTCATTGTTGCCGACAGTAGTCCAAGTCACAGGTATGAATTACTTGTCTTGATTTGCTAACTGTCCTGAATTATGATATATCTGTATGTTCACTACAGGG
GGATCGATAACACTACTACTGGAGGAACCACTCGATACAGGTACTTATTAACAAGGTCTTCAAATATTCACTAATGTTGCGTCTGTCTTGTGATGATAGG
CGGGTTACCAATTGCTCAGTACAACCTTTTTCTGCTTCAGAATGATTCCTTTACGAAGTTGAAAAGTGTTGTGGCTTCCAGTACAAGTGAAACAACAACT
GTTATGGTGACTCATGATGTAAATGGCACCCCTTTACTTGCATCAACGTCATACACTATTAAAACGTTGGCGTTGCAAGCCGATATCGTCTGCGACACAT
TAACGGACGATGGATTGGAAAGTGACGCTCTGACTGTAACAACCGCAATTGCCGCTGTCCCGGCACCACCGTCACAACCAGCGCTACTGCTACTGTCGGG
ATGCACAGCATTGGTAACTGTTACTTTTCCCGAGGATTTTGGCGGAACGAATGTTACCGGTATGACTATAGGAGTTTTCACAGCAACAGGACTTTTACTT
GAGACCTTCGTCTCATTTGACTCCAGTTCGGTCACAGTTCGAAATCTGCTTGCGAATACGAGCTATTCTGTACAAGCTACTTTGAATACGACCATCGGCG
ACTCTGGGTTTGGAGAAGCATTGACATTCACAACGCAGGATCCGAGTCCACCAAGCAAGTTATCCCTGCTTCAAGTCACTGATGTTGGTTCGAGTTCCGC
GACTGTGGTGTGGGGAGGACCACAGGATACAGGGGGAGGTGTTATAACAGGTGATGTTTTACGCATTTGTACTGGTTGTTGCTTGTTACTTGTTACTAGA
AAAATAACTGTTTCTTCGCTTTGTCTCTAGGATATCTACTTTATCAGCGCGCAGTCACAACATATACAACACAAGTGCTCGTTTACAATGGGTTATCCAG
CACGCTTTCGTATCTCGTTGGTGGGCTTTTTGCTAGCACTCTATACATGTTTTCAGTCGTTCCGATTAATCAGTACGGATTAGAAGGTCTCTACAAGGAC
AATGTCTTCACCGCTACTACGTTATCCGCTGAAGTACCGTTTCCCCCAACTAACGTCACCCAGAGTCAAGTCGATGGTGGCTTCATGGAATTATCGTTTA
CCGAGCCATTCTACACCGGTGGAGGACCAGCCAGCTCTCTTACGTTTTCGGCGCGTCTGCAGTCATTGGTTTCTTGCTTCAGTAACGACACTTCGAATTG
CTCAACGTGTTCGAATGCGTTGGTTTCCGATGACTCTACTACTACTATCCGATTGATCGATGTGGTGTCAGCCTCATGTGCTACGAGCGCTTGCATTGAT
AATGAAAATTGCTGTTTGGAAGATGGTACCAAGTGCGGAATTTTAGCGACTACGGCGACGAAGGAATGCACACTAGGCACTCAATCTGGAATCTGCCGTG
TCGAAGGATTACATTTCAGCACGGCGTATATCACAGCCTTAGCTGCTGTGAATTCTGTAGGCGCAAGCCCCTATTCCAACACTATTGTGGTCACCACGAG
TGCCGCCCGACCGCCAGGATCTCCACAACTTAACGCCGTGTCGGCTACGGGAGGGTCAATTACGTTACAATGGACACTTCCAGCGGTAAGTTCGATGTAA
TACCGCTTTGTTGATAGGCAAATTAATGCGTACCGAATGTTTTGATGGCTTCAGGATACCGGAGGTGCTCCAATTGTGCTAATGTCACTAAGCGAAATGG
GAGATGAAGTGTTTGCTAGCGACGTTGCTTTGACCTATACTGCTTGTGGAGGGCTGCGCGCCGACACGGATTATGTATACGCGATCGATATCGAAAATGA
GGCTGGATATGTCTCCCAAACGATGTCTTCCTTTATGACGACTGGAGCAACTCCACCAAGTCTTGTGGTGCTTTACGAAACTTACGTGGGAATGCAGACA
GCgagttttgctgctgccttaTCATGCGACGATGGTGGCACTGGCGAAACACTAACTGCATCTTATCGCGTCTTCCAAGTCGGCGATACAGCTACATCAA
TAGAAGGGGTCGCCTTTTGTTGTACACTCGGAGACACATCGTGCTGCTCTCCCAATGATTCAACTGCATCAGTTGAAGGACCTCCTTGCTGCTCAGTCGA
ACTTTCTGGATTGATTGGGTCGACCGATTATCGCGTCGAAGTTCGAGCCCAAATCTCAACTTTAAATGGCAACTGGGCAACAATGGACTTTACAACAATG
ACTGGAACCCCCTCCAGCCCAAACACATCTCTGTTATACGCGACCCCGACAGCTTTGGGATTGTCACTATTACCTCCTTCAGACACGGGCGGCAGTTCAC
TCTCACTCGAGGTGGTAGCAACGAGTATTGCTACTGGAGTATTCGTTTACAACAATTCTGTGGACTGTCCGATGGTAAAACTGGAGTACGCTTGCCCCAA
TACGCTATCAATTGACAGTATTAACACTACACAAAATGGTTTCTCGTACACTGTGGTTATAAGAGCTGTTGGTACCGGTGGAGCAAGTGCTTGGGTTTCA
AATACGTACGATCTCGACAATAAAACAGCAGGCATGGTTGGATTTGTTCAGCCAGTGTATCGAGGTACCGAAGGCGAGGATATCACTGTGCAAATCACGC
GAATGTATGGAACATCGGTAGTTGAACAGACAACTTTTGATATAACTCCGGGGGTAATTGTATCATCATGGACTTGCTCTCCAAGTTCTGTCGGGGCAAC
CTGCCAAGCTGACGTAGCAGGTGACAATCAGGGTACGTACCAACCAGAAACGTTTTCCTAATGATGATAACTAACCCCAAAAATGTTTTTGCGCTCAGGA
TACGTCACCTTCATGTCTGGCGAGTATACGAAGACGGTCACTATTTCATCGATCGACGATGATCTGTATGAGGACCCACCTGCTGCGTTGAACCTTACTC
TTGTGAGCTCAGAGGTCAGTGGCCTTGGTCAAACCCAATGCCAAGTGATATTTGATGAcaatggagacgctggaaaCTTGGGCTTTGCCACAATACCTAT
GAAGGTGGTTGAGAATGTGGGAACACTCAATATTGTTATTTCACGTACGGGAGGGGTCAGTGGTAGAGTATCTGTGGTGGTGTCATCAACTATGAGCTCG
AGTATCAGTGGATTTAAAATCGATCAAGTCGTGAGCTTTGAAGATGGTGTAGCCAACGCAAGTGTACCTGTTTCCATCCGAAATAGTAGCGAATACGAAA
CGCGACACTTTGTGGTAATGCTCTCAAATGCCACAGGTGGTGCTGTACTGGATGGAATTAATTTGTCAGTGACGGTTGAAGATCAGGGAGATGCGGGTCC
TCCTGGACTTCCACGTGTCGCGCAAGGACCAGCCACTGGTGGATGCACTGAATTGGATTTGAGCCTTCCGACGTACATGGGTGTAAAGGGCTACTCTTGG
TCTCAGTATTTTCTCTATGTTGATCAGCCGGGGAGTGGCGTTACTCTACCGTATTTTACCATGTCGAACAATATCAGCATCTGTGACCTTGAGTACGATA
CAACCTATGTGGCGAGTGTTCGGGTTAACACTAATCATGGAAACGGTGAATTCCGTAGAATTTCCATTTTAACTGGGCCACTTTCAGCGCCAGGTCCAGT
TGATCGCTTCTACGCTGGGATAGTTACAAGTGGTTCGGCAGGGGTGTTTTGGACAGCTCCGATTGATAAAGGCGGAACTCCTATAGAAAGCTACCAAGTT
TCGGTCTTGAACGAAGCTACGAACGATGTACGGAACATTGAGGTGCCTGGGTTTCAGTTGTATCTGTCCGTCGGCATGTTATCTGCTGGGACATCGTATA
CATTTACTATCCATGGCGTTAACTACGGGATGGTTGGCCAGAATTTCTCTATCAGCGTGTCGACTGATAGTCTAGTAGTAACACCACGTCAACCGCCTCC
ACCCGACTTGATTTCCGCTACGGGTGGAGCTCTACACGTCGGAATACTTGCACCGAACGATTGTGGTGGATCCCCGTTAACTACCTACGTCCTCAATATT
GCTCGAAACATGGGAGGAAACTTGGTCTACAATCAATATGCATCTGGAACCGTTGAAAGTTCAACCTTTGACCTGTATGTCGCGAACGTCTCCATCCATG
GTCTTCTGTCCAAATCCGAATACTTCATTACGGTATCACTGCAAAATGTGCAGGTAAGGCATTAATTACGAATGTGAGTTTAATCCGAAAACTaacattt
ctgctgctgtttctaGGGGTGGAGCGAGCTAAGCAATGGACAAAGTTACTTTACCACAGCGCCGACTCCCGTTAGCGGGGTGGCCGCACCAACAGTTGTC
TCTCAGGATCCTGGGGAAATTACGCTAAACTGGGGAACACCACTGGACTCGGGTGGTCTTGACATTATTGGGTACAGGGTGCTGGCACGCTACCAGTTTG
AAAATGGTTCCTGGTCACTTTCCGAAGTTGTGTACGATAACCAAGCCTCGGTGGTACAAACCGTATTGATCTCGAATATTCTGCCTAATACCGAGTATGC
CTTCAGCGTCATAGCGTATAATTTCCGAACGTTATGCCGCCCCGATGAAGATATTACTCCTGGGGATGAACTTCTCATCAAGACACAGGATGGCTCTGTG
CCGTCACAACCAAAAGATCTTCAGGCGATTCAAGTGACAGGTGGATCTGTTATTTTGGCATGGGACCCCCCTCGGTCTTCAGGGGGAAGAGTTTTACTTT
GGTATCTTGTCAATGGTAGCGCTGCAGGCAGTCAGCTTCAATTGATGGCGAATGTCAGTGCGACTGCCTCAAATTCACTCACGCTGTATGGATTTATGGC
TTCGACACCGTACGAATTCGCAGTTGCTGGCCAAAATGCGCTAGGTCTTGGATCGTATTCGTCGTCAGTGGAAGTGACTACGACAGCTGCAAGTTCCCCC
GGCCCCCCGAAATCTCTGCGCCAACTGGCAGTTTCGTCAGGAGGAACAATCATATTAGCGTGGGAAGCTCCTGACGACTCGGGTGGGGCTACCGTCCAGG
AATATAGTGTACTTCGTGATGACATCACAGTTGGTATCGCGACAGCTGTCAATGGAACCACTACGTTTCAGGACCAGAACAGTATCCTGGCTGACACGAC
CTACGTTTATTCTGTGTCCGCATCAAACGACTTTGTCCCCGGTACAAACCCAGCTAAGGTCACCGCTAATAGTGGTGCTGCGTCGGTCCCAGCCCCTCCA
TCGGGAGTCGTTCAACCTGGGAGTGGGTTTATTGTGGTCAATTTGACGGCTTCACCAGATTCAGGTGGTATTCCCATCCTTGGTTTCGAACTAGCCGTGC
TGCGTGGAACAGCGATTGTGAATACTTACACCACAACCAACCCCGTGTTTACAGTGAATGGGCTCTATGCAGTTACACAGTACTCCATTCTTATCGACAC
CGTCAATGCGGTGGGTAAAAGCGAGTCAAGTATGCTGACTGCTACAACAAAGCCAGCTACTGTTCCAGACAAGATGTTGGTTCCTAGACTGGTGGGCGTA
ACTGGAGGTTGTCTACGGTTTGGAGTTGTTGCACCTGCCAACTTTGGTGGTAGTGACATTGTGGCCTATCGTTTTTACCTAAACGGAACATTGGACGAGG
CTGTGGATATATTGAACACCGAGTATGATCTTGTGGGATTAACGGCACTCACGTTTTACGCAGTCACCGTATCTGCGGTTAATGCTTTCGGCGAAAGTGT
ACAAAGCGATCCGTTAATAGTTTCGACCGACGTTGTTACAGTACCTGGTACAGTTCTGAGTCTAGCAATGGTATCAGTAACGCAGGATGCAATTGGTCTT
ACATGGATGTTGCCGCACGATACTGGTGGGGATGCAACTGTAATCCAGTATGACGTTCAATATTCTCCAAGCGCAGGTGATATCAACCAGATATCCAGTG
GGTCTACCGATGCGGTATTAACTGCTCTTGATCCTTCTACACTTTACATTATTCAAGTTCGAGCCACTAACATGATGGGGGAAGGTCCGTGGTCGGACAG
TATATCTGTAACGACGGATCCTGTATCGCCCGGCGTCATTAATTTTGCGACAACATCAGTTAACGTATCTGAAGCTGGTGGTTCGGTTACCTTGACACTG
CTTCGTACCCAGGGAGGGTATATGCCAGCGAAATGCACATACCATACAATCGACGGAACGGCGATTGCCGAGATTCACTACGTGCAATCCAGTGGTGAAA
TCGATTTCGACCGGGCTATGGGATCCCAGCAATTCAATATTAGCATCATCAACAATGATGTGACCGATGATCCAGACAAATATTTTTTTGTCATAATTGA
AAAGTATGATACGGACTCTGGAGCGATTGGAGACAACGCTACAGTGACAGTTACTATTACGGACGATGGTGATTCCGGTGTGGTAGCTTTTGGACAAGAT
AACTACTCCGTCTCTGAAGCTGTGTCGACACTTGCTGTGGATATTGTGAGGACGCTGGAGTTCAGCGGCGGTGGTACCATCGCAGTTGATGTAGTTAACA
CTCTTGGAGACGCTGTCGAAGGTACCGACTTCAATATTCCAAATAAAACCGTCGTATTCGTCGATCAACAACGGCAAACCTCAGTCAACATCACGATCCA
GAACGACTCAACGTATCAAGCACAAAAACTTTTCCATCTGACGCTTCGTGTGGTTAGTGGGCGAATTGCTATTGCCAATTCTACAGTTACTGCTACAGTT
GAGATCTTGGATGATGGAGATACTTCACCACCAGGTTTAGCAGGCGCGgttcaagttgttgcagtaTCAGGAGGGGTGATTAGCGTTTCATGGGTCGCTC
CAAATTACTTAGGAGCAAAAgtggtgccgtcgttggcgtATACTGTGCGTGTAGTGGAAGTTCAGACTGGAACATCAATGGAACAAATCGTCAAAACTGT
TAGCCTTATAGTTCCGCAGCTCAAAGCTCGAACTGCGTATGACGTCTCGATTGCGGTGAACAACACTTACTTTTTGGGAGAGTACACAACTCCAAAGTCA
ATTTTAATGGATGCGCCTACACCACCATCAAAGCCCCTGAATGTTCAAGTTTTATGGCAGACAGGAGGAATGGCAAATTTATCGTGGACGTCTCCATTtg
acggaggtggagctAATATTACCAGCTATCAAGCAAAAGTGAGCTTTAGCGCCAACAACACCTTTGTGGGTACATACATCACGACAAGCGGCAACAACAT
AGCCACGAACAATCTTTCCTCGTTGACCAGCTATAGCGCAACTGTCGCTGCTATCAACCAGTATGGACTCGAAGGAGACCTAAGTAGCGCAGTCTTGTTC
ACGACCACTGCTGTGTCCATTCCAGGAAAACCAAACTCTTTGGTGGTATCAAACGTAACAGGCGGTGCATTACAGGTGGATATGGCACCTCCGCTGGATA
TGGGTGGGGCCCCTATCCTTAACTACACCCTAGCGATGACATCTGCTAAAAACCCGAAAGTATTTCACCGAGTTTATCGAGGCccttcatcgtcattttA
CGCAACCCGACTAACTTACTCGACAACGTACAAGCTGCGGTACAAGGTGGCCAACTCAGTGGTGAGCTTTTCTATAATTCTGCTCTAATTTCGCGATTCA
ACTTAATTAATTGTGCTTTGGGTTTGTTTCTATCAGGGAGCTAGCCAAGTGAGTGATGTGGTTGTAGCGGCCACGAAGTATCTGACACTTCCAGATGAAC
CACAAAACATTGTGGCAGTATCCCGGACGGGAGGTTCTGTCACGCTTTCCTGGTTACCTCCTGTGGATTTTGGTGGTGAGGATATTACCTCGTACGATGT
AACGTTTTTCCTTGGTTACCAAGTCAGTACTCAGTACCAGGAGCGCGTATCGGGGTTCAATGCGAACGCAACGTTAATCACCGCAAAAATCGTGGGGCTG
CAGGCAAATTCTACTTACGGGTTTTCTGTGTCTGGAGTTAACGATGTCAGTGTGTGTGCCAATCCTTCAACTCTGCTCACCCGTACTATTATTTACAGTA
ATACGGATCCATTAGTCTCTCTTCCAGCTATTCCACGTGGGCTTGGAGTGGTCAAGAGTACGTCCGGAATGCAGGTTGTACAATGGTCTGCTAGTGAGGA
CACTGGAGGTGGCTTGTTTGTAGCTTACTTGCTGTATTCAGATACTGGTGGAATCTTGTATAACGGCACAAATACTGCATTTACGTATGGATCGCTGACT
AAGAATACGGTGTACGGCTATCGGGTTTGTGCGTGGAATTCTGCTGGAACAAGCTTACTGAGCGCAGTTGTCTTCGCAAGTACGCAACCGAGCCTTGTTG
CTCCCAGCGAACCCCTTCAGCTCGCTTTAACTAGCAGTACAGGCGGCTCCATTGGGCTGACGTGGCAAATGCCACTggacggtggtggagatgcgATTTC
GGGATACATACTGTATCGTAACACAGTTTGGAGAGCTGGAATTGCGGCGAATGGCTCTACGTTGATATATCTGGATGAACAGGGCCTCGCCGCTCTGCAA
CAGTACGTGTATGTTGTTGGTGCAACAAACTCAATTGGACTCGGCGCAATGAGTGAACCACTCACTGTGTCTACAAGTAGTGCGACCATTCCTAATCCAC
CAAGTGGAATAAATATCGTTGCATGGGGTGGGAGTCTCACAGCGAACTGGACTGCTGCGGCAAATTCCGGTGGAATACCTTTGGTTTTTTTCCGTCTGCA
GGTTCTGGTGGATTCACAAGTTGTATTTACCACGACTACTGACGTTTCGGAGTACACACTATTTGGGCTACGAGCCAGTACTACGTACACAGTCATGGTG
ACTTCTGAGAACGGAATTGGGGAAAGTTTACCCACAACTCAAATTATCACTAACGGGGCTGCTGTACTCCCTGTTGCACCCGCAGCTCCTGAACTGTATA
CAAACTCGACAGGATTGTTAGCATGGATGATATTGCTGAAGTTATATCTCCCGATTGATGATGGCGGAGCGTCAGTTGATCAATTAGTCGTGTATCAAAA
TGGATCAAATATCCTGTCGTACCCGGTAAATGCAATCAGTCAAGCAGCGCTGGGAGACCCGACAGTTCGGTCGGTGATAGCTGAGATAGGCCCTTTACAC
GCAGCCACTGTGTATAATTTCGCCGTTTCCGCTGTTTCTTCTGTAACGACAATTGGCGAAGGTCCGCGCAGTGACGCTCTATTCGTGATGACCGACCCTG
CCACACTTCCGTCTCAGCCGCTTAATGTCATAGTGGTTCTTCGGACATCGTTTTCAATTGTCCTACGATGGGACAAACCAGCAGACACTGGCGGGGATGA
TGTCGTCTACGAGGTTGCGTATACTAATACGAACACTTCGGTAGCTGGCCAAATGGTGGTCAATACTACAACCGTTGAGATTCCTCAATTGATTCCGGGA
GATATCTACTCGATTAATGTGCGCACTCGAAACTCAGCCGGAACCAGCGTTTGGACGCCAGATGTATCAACTCAAACCGACGTAACACAGCGTGGCGTCG
TTATATTCAACATGACGTCTTTGACTGTGTTTGAAAACGTCACAAGTGTGGGAGTTCAATTACTTCGCGTGAATGGTTCTTCGAGCACGATTACCTGCAG
CTATTATCCTGGCCCAGGCTCTGCTATCTACGGCCAAGACTACACGTTACCACCCGAATCGGAGCGGTCTTTCACGTTTGTTGGGGAACTCATCGTACAA
AATTTCACTGTACAAATCATTAACGACGATGTGTACGAGCCGACTCCACGGACAATCAACCTAATTCTCACAGACACTACCCCTGGTCGTAGTGACCCAT
TCCCACCTACGTCTCTTGTAATTACCATTCTGGACGACGGAGATGCTGGAATGATCGGGTTTGTTAATAGCGACGTTGCAGTGTTGGAAAACGCTCGCAT
ATTGACTCTTCCGTTGCAGCGAACGAACGGAAAGAGCTCTGCAACTAGTGTCCATATCGTCCTATTCACCGGTCTCGCCAGTACAGCTCAATCTAATGCA
TTCCGGTTACCAACCGCAACTGTGGACTTCATCGATGGCCAAACCTCGTCGATTGCGACTATTGTGATCATCAACAATGATGTCTATGACTTCCCGTTTC
TGTATTTTTACCTCACACtggaaattgctgctggaggtgcaaCGATTGGAACGTATAGCGTGATTAAAATTGTAATACTGGATGATGGCGATCACTCCGC
GCCTGGAGTGATGGAGGCTCCAGCTCTGGATAAAGCAACTGGTGGAATGCTTCAACTGACGTGGGATCCTCCTGTTAACGTCGGTGGGCAAGATATCTGG
ATTACGGGATACAACATCTCAATTCTCACCACCAACACAGCGAAATCGCTAGTCACACAAACCAACGCGACGGTGCTACCGTTTGGCGGGTTAACTGTGC
TTACAACATACGATTTCACCATTTCGGCAGTAAACGTCATTGGCCGTGGCATCGGTAGTCCAAGTGTGGCGTATTCGACTACGAATTTTACTGCGCCTGG
ACCAACCGCGCAGATTGCGTTGCTTAATCGTACGGGTGGTTTACTCACAGTTGCGGTCACTCCCCCAATCGACAGCGGTGGAGCTTCTGTAACCGGATAC
ATGTTGTATCTGTCACAAGCGGGTGGAGATTATAAGGTTTGGATAAGGAGTCTAAGGCTGATGGTGGCTTGGATCTTGGACTAATAAGTATTGCATTTTG
CTCCATGCAGATGGCTTATAATGGTACAGGGCAGACCCCATCGGTGATTTTTGTAAGCGTTAATAAGGCGAACACTAACTATACCATCCAAGCACAGGTT
TGTCGATTCGCTACGCTTAGCCGGAATTGATGGCGTAGCTGATTGTCATTTTTCGAATTTGTGGATAGGCTATCAACATCATCGGAGCAGGGGATATGTC
GGATCCATTCGGGTTTACGAGTGGGTCACTATCGCATCCAGGACCCCCTTATCTTCCTGATGCAGCTGCCTCACGAACAGGAGGAGCGATATCTCTAGCC
CTCATACCCCCTATTGACACAGGTGCATATCGATTCCAATCTGGTTTGCAGTAGTTGCTACATGCGCTGATGTTGCAATTTTGTGAAAATACAGGTGGCT
ACGATGATGTAACTTACATGATCTATTATCGAGAGCATGGTTCAGATAAAAGATTTTGTGAGGCTTatttcgacgacgaggacctgCAAATAACTGTTTC
CCGCTTGGCGGCAGAAACAACCTACGATATGATTGCAGTATCGCTTGTCGAGAACGATACGGAAAGTTTATCTATGGGCAATCTTTCAAtcgctgcatcc
agcattGTATTCTCTGGCAACGTATCAGCTAAACTGGTAGCAACAGGGTACTTCGACTTTGGCGTAcgtattttttttttcttcggCTCTCGTGACGTGC
TCTAACCGTTGTATAAATTATCTTATAAATCCAGGGATATATGTTTGAAGTTGACACATCGCAAGCCAATGCAGGTGGTACGATATATTACTTGCCTTCA
CTGAGTACCGACAACGGAGCAATTGCGACTACAAACCTGGAAAATTACGCAGTCTACGCCGGCTTTGTTCGCGGTGCGTTCACTACGGTGGCGAATTATA
CAACTACTGGCCCTACAAGACCAGGGAAGCCTCCAGATCCCGTTTTGAACTATTCTACTGGCGGCGCACTGGGTTTTAAAATTTCATGGCCAAACGATAC
AGGTAACGATTGGGATCGATTCGCTGGAAACGAGAGGAACTAACACGTATGTGGATACCACCAGGCGGCATCTCAATCTCAGACTACGAGTTTTTTATCA
ACAACATATCGGTAAGGTGATAGTAACATGCTTTGGTGGTATATGGTACTTTACTGATTCACGCGGGGTTGCATACGATAGGTGGAAGGAATTATCGTGG
GGTATTCGTCCTACGGGGCTTTTGATGGCGAAGTTATTGTGGAAATTGGAGGCCTGATCCCTGAAACACCATACGAGTTTTACTTTAGGACACTGAATGA
TGCATCTGCCTGTCCTGGGCTCAGTGACGATACTTCAGACGAAATCCTGTGCTCAACAGGCGTGGCGAGTTTGCCCCACACGGTCCAGCAAATACAATCA
ATAGGGGCTACGGGCGGTGGCATTCACGTGGATCTTAAACCCCCGAATGACAGGGGGGGTAGCCAACAATTGTATTACCAGGTTTATATGAGCTCAATTC
GGCAAACACCCACCTGGAAACTTGTGTATAACGATACGGGCACATCCTACtggcagacgcagctccagAAAATGACGGATTATCTATTCATGGCGTCGTG
TATGAACGAAGTTGGCTACTCAAATTATTCGACAATTGCCACTTTAGGAACGACGCTCATATCGCCACCTGGACCACCAAACAATTTGACCTTGATAAAA
GCAACAGGAGGTATGGTGCAGTTTTCGTGGAATAATCCTGATGATGACGGGGGTAGTTTGATCACCTACTACACTGTAAACGCTGGCGCTGTCAACGGCA
ACCTCGCTCTGGTACAACAGACAACAACGACGGAAATCATTTTTGGGGGGCTTTTGGCAAACACAGAATACGAATTTGATGTGTATGCCGTGAACAGTTT
GGGGACTGGGTCGGACTCTGGGGTGAAAAGTTTCTCAACCACAACAACCACTCCTCCGTCACTACCAGGAGTACAGACTGTCTTACTACTGTCTGGAGGG
TCCGCTACGATATCCGTTCAAATTCCAACAGACACTGGAGGTGTCGAAGTTGATGATCTGGTGTGGATCGTGTTCGCAAACGGAGTGAAAATCCCGGCAG
ATTCCGTTCGGCGTTTGTTGGCTGCACCCCCGCCAGCCTCCACCGCGCGCCGTCTAACCTCAAGGCGGCTCGCCTCAGACGGCGGAAGTTTAATCTACCT
TCAAGCAGGTGGCTTACTACCGTCCTCAACTTACTCGTTTACGATTCAAGCATCAAACACCGTTGGTGGGAGTGGAATTACCAACGAAACAACAAGTACG
ACGACAGTGGCTACTGTCCCAGGTGCGCCCGATCCACCAACAACGACGGCCATCACTGGAGGTGCAATTGGACTATCATGGACTGACCCAGTTGACACGG
GTGGAGTCCCATTAACCTCGTACCGACTAAGTATGACAAGCCAAGGTGAGGAAGTGGGGAGTTGCCAGGGGATGATTCTTTCGTGCACTATTGGGAGTTT
GTTCTCCATTACTGGTTACGGAGTAACTCTCGTTGCATACAACCCCGTGGGTGCATCTCCGAATAGTACGCTTGTTACGTTCACGACGACGAATACTACA
CTTCCACGAGCACCCCAAGGTGTCCACATTGCGGAAATATCGAATACGTACGTCACCATGCACTGGTCTCCGTGCATCGACTTTGGGGGCGGCTACGTCG
AAACCTACTGGATCAGTATTAAACAAGCGTCGAACGCTATCATtaccttctccagcagcatacCCGTTGCTCAGGAGAACGCCACCATTTTCGGTTTAAC
CCCTGTGACTGATTATACCGCGACGGTTGTATGTACTACTACGAATTTTTGTCCGTTTTAACAGCAGTTTGTCTAACTCTTTGATCTTGTTGTCAACAGC
GTGCAGTCACAGGTGATGGCCAACTCGGAGATGAGAGCAAGACTATCTTTTTCACGACACCACGTTATCCTAATCAGCCTCGACCACCCGCAGTTGGTTG
CCGTAAGTACTTTGTACGTTGGATTTTGAGGATTGGGACCACCACGTAACCTTTCGTTTTTACTTTTTGTTGTCGAAGATTCACGCCAAGTGGCAATCGT
TTTCTGGGAGGCTGAAGACGATGCGGTCAGTTATCTTCTTTATCGGGATGGTGCGCTATACCGTGACAATGGTGATGACGTCACATTCGAGGATCCAATT
GTACTTGGTACAACGTACACCTATGAACTACAAGTGAAGAGGTCAGATGGCTCTATCAGCGCCCTCAGTGATGCAACGACGTTTGTTGCCACAGTTCCCG
TGACTAGTGGTTTTGACTGCGAAGGTGTTAGAGGATATATCCACTGGCACGACTACAAGGACCTGGATCATGAAACTTGGACGATCATACCACAGAACCA
AACTGGCATATCAATCAATGTAAGTGTGGACAAATTATTAGCTGGATATTGGATATGTGAAAATTAACGGTATTTTGTATGTTTTAGATCTCCATGTTTT
GGCTCGAATGCGATCACGACAGTTTGACTATCAACGTGACAGCAAACGGAACTTCAAAACAACTCTGGAAAGGAGGCTGTCACCGCGATGGGGACTTTGT
CGTGTCAACTGCAGCTGGTGTTGATAGCGTTGTACTTTTGTTCTCATCTGATGAGAGCGTGACGTATGAAGGGATGGCGATATACTACGAATCTGTCGAT
CCGATAGATGCAGTAGAATCTGTTTCCACACCATGCCCTCTCTCGACTACCGGGTTTTGCTCAATGAATGGGGCTTGCCGAAAGGGTTCGTGCTCGTGCT
TCAGTGGATATGTGGGGGAGAGCTGTACCAATGCGGTGATCTGCCCTCAGGACACGTCAACCTGTACAGTAACGACATGTGACCCAGTGTGCTTAGAATC
TCAGAATGACGTGATCGTGGTCAGTGTAAATGGAGACGACACTCAAGGCACGGGGCAGCGTATGGATACGTCTGCGACCGGAACAGATCCTAAAGCGGTG
AAGTCGCTTAGACGAGCCCTACAACTCGCAATGTCGAACCAAACAATTTTACTTTATCCTGGCACCTACAGTGGGATTGACAATTGCGGTTTGACTATGG
GAATCGGTAGCCTACTCgttcgaggacttcgagGGCACATCGTAACTACACTGGATTGTGGATCCTTGCTAAATGGTGTGGTTATCACTGGCGTGTCTGT
TCGCCTGGTTGGATTGACAATACAAAATACTGTTACGAGTACTGATGGGGCTGCAATTAGCGCTTCGACTGCAATGGTTCAAATGGAGGACTTATTGATC
ACTAATGGAGCTTCTCGCCAAAGTGGAGGTGCAATTTATGCGTACCAATCCCAACTGACTCTTACGAGCTCGAACATAGCGTTCTGCACCGCCGTCACGA
AAGGAGGTGCTGTGATGTTGGATGGATCTACTATGGTTCTCAATAGTTCAATTATCACGTTGTCCACGGCTGCGGAAGGAGGCGGGATATATGCACAAGA
CACTGTGAGTGTGAACGGTGATGACGAAAGCAAGATTTGGAATAACACAGCCACCGTAAATGGCGGCGGACTCTGCGTAGGTGGAACATTCAATGGCGTA
AACTTGAACCTTTTGCAGAATATGGCGTCCGTGGGAGCTGGCATGGCAGCAACTAGTGGAAACTCAGCACTTTCGCGAGTGATTATAGCTGGGAATTACG
CAATAAATGACGGTGGAGGTGTCGCGCTGCTCAACGTAGCAAATCTGATTTTACAGAACTCCCCGATACGTGGGAACCTTGCAGAACGCAACGGCGGTGG
AGTTTATATGGAATCAAACGGAACCATTGAGAGTAGTGTGGATTCTGAGATTTACAACTGCTCGGCAGGTACGCGGATAAATTGGAAAAGGGTTAACTTA
TGGCTGAGCTCGTTATGCTAACGATATCGTGCTACTTGCTTTGATGTTAGCTTCTGGTGGAGGGTTCTACTCTGGGGAATGGACTCAACCGACAGTAAAC
AGCCTCATTGTTCGTTTCTCCTCAGCAACGATGTCAGGAGGTTGCGCTGCATTTTCAGGTAGTTCAGCGAGTTTGAGCAACGCAAAATTTGTGGGATGCA
ATGCACCTACAGGAGGTGGCATGTATGCAGGTACCATGAGTAAAATTTATGTGCTGTACGCCTCCGTTGAAAGGtgttcagcagcaaatggagcTGGGAT
GCACATCGATTCGAGCTCAGTTGTGGGAGCAGACGATGGTTCTAACTCCGTTGTACGAGACAGTGAGGCTGACACTGCGGCTGGAGGTGTATTTATTACT
GGAAGTCAAAGCTCAATCCAGTTTTTCAATGTGCAGAATTGTTCAGCATCTTTTGGAGGTGGCATCGCTGCACAAAATGCCTCATTCGTTACGATGAATT
CTATCGACATTTTTAACAGCAGCGCAACTCAAAATGGTGGTGGATTATATGCTCAGTCTTCGACAATCACGGTGATAAATGTTACAACAACGGACAATAC
AGcgattggtggtggtggagtgTACGTTATCGATTCAAGTATGTCGGGCTCAATTTCGGTAAGCGGGAATAATGGTGCCCAAGGTGGTGGAATTGCCACA
TCTGGTGTTAGCACAGTGGAAGGAGCTATTATCACCTCGAATACGGCCGCGCAGagaggtggtggtgtgtcGGTGGAGACTGGGGTTTTGACGTTAAAGT
CTACAACTATCCAGTCGTGTTCCGCTCCCCAGAGTCTCGGTGGGGGCATTTCGATCATGAGCGCTGATGTTAAGCATTATGCATTGATTGTTCAGAACTG
CACATCGGTCCGTGGCGGAGGGATATATGCGAATGCGTCGGCTTTCAACCAATATCCAAAGGAGGAGAGCACTGGCATGAGCGAGTATGCAGCATTCTTG
GCACATAACAGTGCAGACGAGTACGGTGGAAGCATTTTCATTGACGGAGAAGGAACGAATGTCAGCGATATTGTTATAACGGATAGCAGCGCCCAGTTTG
GAGGTGGACTAGCTGTTTTGGACGCCCAAGCGTGTGCCATCGTGAATGCAGATATTTCGTTCTCGAATGCTAAAAATTCCGGAGGTGGTTTGTTCTTCGG
ACCTGGCGTTGATTGTACATTCCGAGATTCCTCGGTGACCTACAACTCAGCAGAGCAATCAGGCGGCGGTCTCATGGTCCAAGAGGCTACGTTGTATCAC
TCAAATCTGGAAATATCTACCAATGCGGCAAATACTGCAGGTGGAGTGCATCTGAATAGTTCTGAGCTACCAGCAAGCTTTTACTCGTGGGACGACGTTA
GTTCACAGAGATCACTTATCGACACTAACACTCTCGATCATATTAACGGCAGTGGAGCAAACGTCCTTTTCACCTGCGCCAATAACTGTACTTTGTCAAG
CTCGGTCATTGCTGGTGGTAACCTGACCTTGGGGAAAGGCGCCGGGGTGTTCATTTTGGGTCGTGGGAACGCTACAATTTCAGATTCTCTCATTATTAAC
AACACAGCTCTGATAGGGGGTGGTATTGCAATTAGTGATGCTGAGATAACGAACCTGGAAAATGTGGCTGTTGTGGGGAATGTTGCAAATGATACTGGTG
GTGGTTTATGGGCCGAAAGGGTAGTGTTCTACCCAAATATATACATGACCAGTTGCGTTTTCTACAATAACTCAGCAAACAATTCGGGCGGGGCAATATC
ATTCTTCGGTGATGTTTATACGTATAGCACCTTATTGCTGGTGGTAGAGAATCACGCTGGTAATAGCGACtctggaagtggtggcggaTTCTACGCCGAG
AATGGAGCTCAAGTGGAGGGCGACACCTGGTTGTTCTTATCGAATGACGCCACACTCGGAGGGTCCATGGCTGCAGTAAAAGGTTCTGGCCAAGCAGGCT
CTACCATTAGTATCGAAACGTCTTCGATCACTCGCGACACTACCAGGTTTTTCACGAAGTCGTGGCAAGATCAATTCCAGAATCTGGTGGGGTTCGAGTA
TGTTGCAGGCCTCGCCCAACACAAGGTGGCGGTACAAAAGGGTGATCTCGTCTATCTCTCGGACGCAGATTCCATTTTTGAGTTATTGTCATCGTTCGCG
ACATCCGGGTCAGCTGATGCCGGAGGAGGGTTTTATGTCAACGCTAATGCGGTTTTCTATAGCCAGTACTCGGAAATTAGCTCCAACAGCGCAAATGAAC
GAGGGGGCAGCGTGTGCGTGTCGAACGGCGCGCAAGGGTATTTCATCTCTATAAAAGTGACAAATAGCGGTACGTTGTATGCATGCCTACGAATACTTTT
TACAGCGCTAATTGGTTTTCACATGTTTGTGTCAAGTGTCCAAAACGGATGGGGGTGGGATCTATGTGGACACGTCTTCTAGAGTTTACTTTGAGAGCTC
CGATATATCCGATAATTTTGCGGATGACTTCGGAGGGGCCATTTATCTCGATACTGGGGATAAAAACACGGTCATCCTAAATATGACATCGGTGGAGCGC
AATATCGCTAATGGGGAAGGGTGCGGTAAGAAGTTCTGCCAACTTGTTTGCTTCTTTACGGAAAACTAGGTCTGCTCACAAATTGCTTTTGTGTGCTGTG
ACCGTCACCAGGTGTCTTTGTTGGTCGCGAGGCTGTTTTAGCTGGCTACAAATCTCTGTTTGTCGGAAACGGTGGCGTCACCTCAAGCGGCAAAAGCGAA
GGCGGGGGTGCAATTTCTGCAGTTGATGGTGTTGTGAAGCTCTCGAATTGTACATTAGCCAACAACACTGCACTAGTGGGAGGAGCAATCCATGTTGATC
GCGGCGGGTCGGCAACCATCACGAGTTCGGTGTTCACGGGAAATACTGCAGATCAAAGTGGAGGAGCGATTGAGATAGACGCAATGGCCAGTGTGACGAT
CGCTCTACATACTTCCTTTGAAAACAATGTGGCGGTTCTTGGAGGCGCCCTTACTGCTACTGGCACATCTACTACCACACTCAAATCGGTGATGTTTCAT
CGCAACCAAGCCAATGAAAACGGTGGAGCTCTTTTTGTTACGGATCAAGCGAAGCTTACGTTAACAACGGGGGAATTGACCAACAACAGCGCCCAGCTCG
GAGGTGGTCTGCATAAGGACGAGCAGGCTACTGTTACAATCGCGAGTTCCAGCTTTATTGGCAACGCGGCCTTCATTCGCGGAGGTGCATTTTACTATGA
ATCCATAGTGAATACCACAACTTCTGGAATCGCGTGCAAAGAGAACACAGCTCCAAGTGGAGGGTGCATGTTTTGGATATCAAACAGTGAAAATCTCACA
GCTGTGCAGCCGTGCACGTCTTGCACAATGGAATCGAACACAGTGTACGACATCGCAACTAATACACGAGACGTCCAGATAATGTGGTGGCCAGACAATG
TCACAAGTGGTGTGGAAATTCTCGAACCTGCAGACGAAGAGTCGATCGATGTGATTGAAAATCGGAACGTCACACTGGACGAGACGAGTTATGTTTGGCC
TCGACTAAAGGCTGTCGATCTCTACGGACAAATTGAAGTATTGGACAACCAGACGGCATGTTCTGTGAGCGATGGACTCTGCACTGAACAAACAGAGACG
CTGCGGTTTATGCCTAACTTTGAAATTCGTGCAGCCATTGGGGTTCTTTCCTTTCGTCAAGCTTCATTCACTGCCGCTAACAGGACACCAGAAGAAGGAG
TTTACACGGTAAACGTCTCGTGTAAACTGCCTGGATCCGAACCTCGAGGTTTTGTCCAGAATGTGACGTTGTTGCCTTGCCAACCTGGCTTCTCTGTTAA
CCAGGGGTACGTGTgcaaccccccccccccccccccaatGTGCGTTCTTTTTTCTTACCAATTTTGTGTTTCCAGTGTCTGCCAACGCTGCCAAGCACTA
ACGTACAGGTATTCAATTGCGCTTTAAGTAGTTTGGTGGCCAAACTGTGGCTAACTTCACACTGTGTGCTGTAGTTTGGATGGTACAAAATGCTTTGACT
GTCCGTCTGGTGCCCAGTGCAATATGTTAGTACGACGCGCGACGGAAATGATGGCACAGGAACTCGGTACCAAATCTCCACGCACACAGGAAGGGTATTA
TTTGTTCACTGCTCCCGCTTCAAAACAAGAGTCGAGTTGTCTCAAACCTTCGCTGTGGAAAAATGAGGATCCatgcaagaagctggctCTGCAAAACCCA
AGTGCCAATCTTTCCGATGTGATCACCGAATGCTCAAACCTCCCTGGATTCAAGGTTTATTGGGGCCCCGATCGTCTTTTCCCGTGCTTGTCGGGGAAAA
GTTTCTACACATGCGACGTACGTTGTGCTGTTTGAAGTTTTGGAGATAGTACCTCATTTGATAATACGTTGTGTGATCAGGTGGAGGGGGCATGTAAGGC
TAATGTTTCAATGGAAACATTGGCACTTGCAGCTACAATAACTGATGCTTCATGTGCCGGTGGGTACGACCTTGCAATCTGCTCGGTGTGCGCCGCTGGA
TTCAAACGAGCCAGCGATAATTCGTGTCTACGTAAGTACCATCCGCTTGTGTGCCGGTGATAATATTCGAGCAAACTAACTTACTCGTTGCATGATGTTT
ATTTCGTGAACGTAGCGTGTGAGAAGGTGAATGCACAAGTTCGAGCTTCGATTCGATGGCAAAACTTCGTCATTCCTGGGCTTATGGTCATTACCCTTAT
CGGTGGTATTTACGGACTGCGAATCTACCTCCGAGACATGACGGAAATTGGTCTCCTTGAAAAAGCGGAGGCCGATAGACGGCTGAAACCTCCTCAAGCC
AAAGATTCTCCCAAAATGGCTGCACGCATTACTCGACGCTTGAGTGCGACGATCACGACAATTCGAAGACAATCTTTGGCTGCCACGGAGGCTGCCACAG
AGGAAGTGGATACGTTCCAAACTAAAATCACTAACGTTTTGGAGAGACTTTGGTATGGAAACCAGAAAAGCGTTTTTGGGATTGATCCTCCCCCGAGGGT
ATTCCCGGTGAGTCCAAGCAAGTTCAAGATCTTTGTTGGCTTCTTCCAAATATTTGGAAACTTCCAAAGCTCCTTCGTCGTGAAGTGGTCAACCAATATC
CAAAATGTCATGAATTTCTCTCAGAAATTCAATCTGGTACGGAAACCAATCGATGCCTGCTTTACTACCGCTAACATTCATTGGTGTGTCTAGGACTTCG
TCGCTATTGCTGGAATCGACTGTGTAATCACGAAAAACTTTTATTTCGATTTCACGTACGTCGGCTTTTTTTCTGCTTTAGTATGGAGTCAGCTTCAGGT
TTATCTGAATGTCTTTAACCATGTGCTTGCATCAAGTGTCACCGTGGGTCTGGTGGTACTTGCCCTCGCAGTTATCACCGCGTACTTCTACGCAGGAATG
CGTAGCTATCGCGCAAAACTGCGGTTAATCCCACGAAATTGTCTCCGCTGCGGACTCCCAGTGCTCGAAGGTGAGGTGATTCAAAATGATGACGAAAGTT
TCAACCCTCTTCGACTACTGCGGGGTTGGTGGAGATCGCGCAACCTCTATAAGAATGTTGTGTCCGGTAACTCGGTGGAAGAAAGTTTTAACCCTCTTCA
ACTGCTGCGAAATTGGTGGAGACGAAATAATTCCAATACGGATACCCGATCTGCTAGTCcgaaggaagaagatgaagagtaCAAAGCTCGTTCCATGCTC
AAGGAAACTCGTGAAATGAAGCGCAAGTTTGGGATGTCCCAGGTCCGCACACCGTATCTGGGATTGTTTCGATCACAGCATACCCAATGTCCTATTAGGC
GGCATGTTCTTTCTGGAAAGCTGCTTGAACGAACAATTCGCAGCAATCTTCGCGTGTGGCAAGCGCGAGTCAAGCTGCGCATGAACTATCTGACGTACCG
AAACAAATGTCTTAAGCTGTACTGCTGGATGGCTCTGTTCCTGTACCCATCTGTCTCCAAGACAATACTAACAGTTTACAATTGTCAAGAGGTTGGCGAC
ATCTATTATCTCATTGCGGATCGGCGTCTGGTATGCTACAATGGCGAATGGGCTGTGTTTGGGATGGTCGCTACGATCGGTGTGGTTGTGTGGGTGGTGG
GGATTCCTTTCTTTTTCGGTCTCCTTATCTGGTTAGCACAAGGTCGTGGTGTAGACGCCCGTGTAAGGTTATTGCGAAAAGCCCATATGCGCGTACAACT
GCTGAAATGGCTTAAAGAAGTGAAGGAACGGCACATTGAGGAGAAGCGAATTGTTTGTGATATGGACAACATCGACGTGCAGAACGAGGAGCTAGCGAAG
TACATGAAGTGCAGGAATTTGACGGTATGTTATTGCAACTCTTCAACATTGTTGATTTGTTTGTAGACTAATAGTATGATTCGAATGCAGGACTCCACGG
TTCAGGCTCGGCTAGGCTTTATCTACGCCGAATGTAGGTGATGACTAAAGCTCTCGCTAGCGATTCGAAACTAACCATTTGTTTTCCGTTCGTAGATAAA
GACGAATACTGGTGGTTTGAAGTTGTGGATCTTTCTCGAAAGCTCTTCCTAAGCGCGGTGATAGTATTTGTTCAGACCGGAAGTGGTGTCGAGCAAGTGC
TACTTGCTCTCGCTGTGTGGTGAGTTTCTTCTAAATTGGACTTGTTTGATCTTCGTTTTGGCTGATCAACTCATTAATTGCTATTGTTTTCACTGGATTC
AGCTTGGGGACCATGTGGTTCCTGCTGTATTTCCAGCCATACGACAACTACACAGACAATCTCATCGCGAGTATAacacagctgcagctttaTTTCACGT
TGTGGCTTGGGGTCATGATCCAACTAAACAACCTCAACGCTGAGTCGCAGATCAACGTGCAGCTACTGAGCTTCCTGCTTGTAGGATCGTGCATTGTTGT
CACGGTGTTTGGGTTTAGCGCGACCGTCAGTGAAGGAATTGCGGAATCACGGAGAATATACGCAGAAGCATCCGTCCTGCGCAACGAAAAAGTaaaggct
gcagctcgaaaaATGTGGTTCAGGGCATTCAACTACGCTGCCTATAAGAGACAGATGGAGCTCAACGACAACCAGTTCAGCTTTCGTGATTTCAGCGTGT
CCGCCGTACTAGGAGCTTTTCgcaagttggtggtggaagaaaAAATGTTTGCAGATGCCGCTGCCGAGGTGGATGACCAACCAACGCGAGCACGCCTTTT
TTCATGA