Transcript Name :
Phyag_g6
Orientation:
(-)
Number of Exons:
8
Description :
U4/U6.U5 tri-snRNP-associated protein, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, UBP-type17.427PS50271
Ubiquitin carboxyl-terminal hydrolases family 217.915PS50235
HmmSmart predictionP-Valprediction_id
Zinc finger, UBP-type2.5SM00290
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-514
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
zinc ion bindingGO:0008270IEA
obsolete ubiquitin thiolesterase activityGO:0004221IEA
ubiquitin-dependent protein catabolic processGO:0006511IEA
KO ID
K12847
*** None ***
Sequence
        2068 bases(100 bases per row)
ATgcccaagcgcaaggcgTCCGAGGTTGAgggcgatggcgatggctccTCCGCTAAGCGCCGCAAGTGCCCGTACCTGGACACGATCAACCaccagctgc
tggacttcgacttcgagaaggTGTGCTCCATCAGCCTCTCGGACCAGAACGTCTACGCCTGCCTAGTCTGCGGCAAGTACTTCAAGGGCCGCGGCCGCAA
CACGCACGCCTTCACGCACTCGGTGCAGAGCAGCCACCACGTGTTCATCAACCTGCAGACGGACAGGATCTACTGTCTGCCGGACAACtacgaggtggtg
gacaacACGCTCAAGCCCGTGCAGGACGCGCTCCGTCCGAGCTTTGAAGGTGCAGAGATCGCCAGGCTGGATGGGAACCGCATCCTAGCGCAGGACGCGT
TCGGCGTCTCGTATCTGCCAGGATTCATTGGCCTAAACAATCTGAAGCACACAGATTACATcaacgtggtggtgcaggcgctggctCATGTGCCGCCACT
GAGGGATTTCTTTCTGAGCAATAAAATGGGGAAGATCAAGTCGAAACTCGTGCTGCGTTTTGGAGAACTGCTGCGGAAGATGTGGAGTCCGCACAACTTT
AAGAACACGGTGCGTGACGGTTGGCTGGCTGGTTTTGATGGGGAGTTTGTAGCTGAGCTGACTGCTGTGGTTGGGATGGTGCAGATAAGTCCACACGAGC
TGGTGCAAGAGATCTCagtgagcagcaagaagagatTCCATGTTGGAACACAGAATGAAAGcgtggagctcttggcgtggctgctgaacgagttgcACAG
GGTAAGGTGACAGACGATAAAGCTGCGACTTTGTGCTGTTGAGACTAAGGTTGGTTAATGTGCTGCGGTTGCAGGGACTTGGTGGATCGAATAAGCCCGG
AAGTAGTATCATCCACACGTGTTTCCAGGGTTtcgtggaggtgacgacggaTGATGAGACGAAAGCTGCGTCGGCGGATGTTGCGGAGCGTGAATCAGCA
GTCACCACTACTGTGTCACCGTGCTTGTAAGTTTATTCGATCCCAAGTTTCATCTGTGGCCAGCTCTAAACGTACTGCTGCGTTTGTAGGATGATGGCGC
TGGACTTGCCTTCGACACCGCTGTTCAAGGACTCTCAAGGAGGAAATATCATTCCTCAGGTACACTCACAAGAACCATCTGCACGTGCATATGGCAGTCA
AACTAACTTTTTTATCGCTGTTGGAGTAGATCCCGTTGTTCACAGTGCTTGAGAAGTACAATGGCTCCCATGTTACGCATGTGCTTAAAGGTTCCCAccg
actgaagaagacgtaccGGATCGACCGTCTACCTGCGTACCTTATTTTCCACGTGAAGCGTTTCACGCGAaacaacttcttcatcgagaaGAATCCGACG
ATTGTCAATTTCCCCGTGAAGAACCTGGAGCTGCGTGACTACCTGAAGCTGGACCAAAGCCTCCCGTCGGAGGACGAGCTTCGCAATAAGTCAATCTCCG
AATTGCGAGCTCTTTTGCGCAAGCACAATCAGTCGAGCGAGGTGAGATTACTGCTTCTTGGTTTTACTACGAGGCAAATGCGTACAGAATTTAAATGGCT
TGGATATGTGGTTTGTGGCAACAGGATTGCGTTGAAAAGTCCGATTTAGTCGAGAAGATTTTGCGCGTTACGCTGCCATCAACTAAGTAAGTGCAAACGG
CGATTGGGCTACGATCTGGTGAAAATGCAAAAGAGTGCTGACATTTGCTGTCTGATCGCATCAGGTACAACTTAATCGCCAATATCTGCCACGACAGTCC
TGTAACTACTGGGCAAGAGGCAGCGCTTCAGACAAACCCCCTGACGGAAGGCAGCTAtcgcgtccacgtccagAATAGAGTACGTGGTTTGAAGTATCAA
TGCACGGGAACAACATCGCACTGACGCAGTACTGTGTAATCACGAATTTATTTATCACAGGCAACGGAGCAGTGGTACGAAATCCAAGACCTGCACGTCC
AGGAAACGATGCCCCAGCTGATCGGTGTGTCCGAGTCGTACTTGATGATATACGAGCGGAAGGCGTAA