/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_6e74c2b19a95d138c202033784b8a456 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1642459 -w 120 -web -o /tmp/images/bd_log_output_file_6e74c2b19a95d138c202033784b8a456
Transcript Name :
Phyag_g32
Orientation:
(+)
Number of Exons:
6
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ankyrin repeat9.511PS50088
Ankyrin repeat-containing domain10.365PS50297
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-75
135-237
98-111
76-97
112-134
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        2082 bases(100 bases per row)
ATGAAGCTTCGcgtgcgcttcctgctcgGTACGTCCTCGCCCACAGCTCATAGCTCCCCCGCCGCTACAAACTAGCCACCTATTATGCAGGCAACGCGTG
CAGCTTTATAtcgttgatgctgctgctagcagcGAGCAGTGGCCACAAGTGGGCGCGCGACGCTGTCAACTCGGTGGACATCGGGCTCTGGTACCTCACG
GTGCGAAACTTTCGTCTCGAATCTCTTGATCCTTTATCTAACGACCGCGAATCCCCGCTAGTCAGGGTACAGGCGTGCGCTACAAACTCATCAACGCTGG
CGCCCCAGTCCACAGTACGTCGGCGGACCAACCTTTCGCGCTTTACAGCCGCTTCTGGTAAAGTGTTGAGAGTCTTCTGCTGTTGGTCGTGCGAACTGAC
GCTCGGGTGATCCACCAGCTCGCTCTCAATTGTTTCCTCCAGCGATCCGTGGTGTCtgggagatgctgcagccacgaggGCCTTTGTGgtcttggcgttg
ctggccgCCATTGTCAGCTTTGTTCTGAGTGCTATGGTGGCGCTTGATATCAAAATCCCCACGTGGaatggagaaggaaaagagGCCACACTAGTCACTC
CGGTGGTGTGCTCGTTGTTCGAGACAGTGATGCTGATCCCTGCGGTGACGTTGTGGCATCGCATGGTGACCGACTACGACGAGCAATGCCGGGAAGCAAG
AAAGATCGATACGTTCACATGCATTGAATTGGGCTCGACGCATAGTTGTGCTATAGCTTCGAtcccatttgctgctgtcaccTTTGTGCTGTGGCGGCTT
TCACATTCTTACCACGTGAGGTTCTTGGGTTCTTGAgtagcaccaccaccaccccTGTATGGATTGATTTGTTTTTGGTCTCATTGGTGGTGTAGGAAGC
GAAACGAGATGGCAGAATCGCCGATGGGTTTACGCTGGCGGCGAAAACAGGCAAAAATTGTCAATTTGTACCATGTTGCATGTAAGACTGAAGAGATTGA
CGGGAAGTGTGATTTCTCTTGCAGACAACGTCGACGAAATACTCTCGGGCATCGCAAACAATATAGATATCGATGCAAATGGCTCTGATGGCAGAAACGC
TTTGCACTGGGCGTGTACGCTGCACCGCACGAGCATTTGCCATGTCCTGCTGAAGAAGGGGGCTTCGATTAGTGTGAAAGATGTACGTTTTGTGAGTGGC
ATTACCTCCTACGGAAGCTAAGCTAACACGTAACATGTGGACATTGCTTTTTTCTTTTTCACAGAGGGATGGCTGGACTCCACTTCATTGGGCTAGCCGT
GTTGGCAATATGGATATCGTGCGTCTTCTGGCAAAGTGTGGTGCTAACTTGAACGTACAGGACCGATGGGGAACAACTCCTTTGATGTTGACAGTCGTCG
GTGAAAGCAAGCTCGCTGCGGAAACGCTTATCGATCTGGGAGCTTCAGTCAATGCACGAAATGTGGGTCTTCATCACGATGGATTGCACCCTCCAAGTAG
TGCTCACGTTTTCCTTGATCTATAGATATTTGGGCAGACGTCTCTAATGCTCTGTGCCGAAGGAGGAGCACCTCTGCATCAGCTAGGCATGGTGTTCTTA
AACGCTGGATCGGATATCACCTTGCAAGATGTACATACGTCGGGGTCAAACATTCATGGTAATATCCACAGATGACTAACAATTGTATGCATGACGTTGC
AGGCACAAGGGATGACAGCATTGCACTATGCGGCTGCGAATGGTAGTGTTAATTTGCTGATGAAcatgctccagcagtgcgaCGCTGAGCTGGTCGATAA
GACGAACAAGGTACCTCAAGCTTAAAATTTGTCTTCACGAGTTTCTGGCGACCAGCGCTAACGCTCTGCACGTAAACTTACGAACAGTTTGGAGAAACAC
TGTCGTATCTCGCTGTTCTTCACTCTAAACCGAAGATATTGGACCTCGTGAAAAATTGGAGAGAAGGAAACCCGATTGTTGCATctcacgacgacgacaa
tgaagaaggaggaggacacgATGACAGTACAGAATCatccgacgacgacgatagcgacgacagcagcgaagaggacgacTAG