Transcript Name :
Phyag_g35
Orientation:
(+)
Number of Exons:
6
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Regulator of chromosome condensation, RCC12.7PR00633
Regulator of chromosome condensation, RCC12.7PR00633
Regulator of chromosome condensation, RCC12.7PR00633
Regulator of chromosome condensation, RCC12.7PR00633
Regulator of chromosome condensation, RCC12.7PR00633
Regulator of chromosome condensation, RCC12.7PR00633
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site7.602PS50096
IQ motif, EF-hand binding site7.437PS50096
IQ motif, EF-hand binding site7.291PS50096
IQ motif, EF-hand binding site7.675PS50096
Regulator of chromosome condensation, RCC113.057PS50012
Regulator of chromosome condensation, RCC115.831PS50012
Regulator of chromosome condensation, RCC114.484PS50012
Regulator of chromosome condensation, RCC116.795PS50012
Regulator of chromosome condensation, RCC115.931PS50012
Regulator of chromosome condensation, RCC116.534PS50012
Regulator of chromosome condensation, RCC111.75PS50012
HmmSmart predictionP-Valprediction_id
IQ motif, EF-hand binding site4.4SM00015
IQ motif, EF-hand binding site0.021SM00015
IQ motif, EF-hand binding site230SM00015
IQ motif, EF-hand binding site51SM00015
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Regulator of chromosome condensation, RCC1IPR000408
*** None ***
InsideOutsideTMhelix
1-888
*** None ***
*** None ***
TypeScore
mitochondrial478
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        3219 bases(100 bases per row)
ATGCCGCGGACTTCCGTACCGAACAATGCGAACTCGCCGACGATCAACCAACCACAACATaatgcagcactgcacatgccttcaactgctgctgccgatt
CAATCCCCGGAGACCACAACCCAGAAATCAATCCGCTCACTTCGTACGATGACCTACTTAGTGCAATGACACCGTACCTCACCTGCCAGCGATGCAACAG
CGTGACGTTCATCGATGTGCAGCGAGTGCGACGCAAGGCCGACCAACTGGCCGCCTCCATGCAGCCTCTCAATGAGTTCGGCGAAAGTGACGACACCACC
ACCCTGTACGAGCAAGTACCAAAATGCCCAGGTTGTGGAAGTACGCGATATCTACGAGCAGGGGTTGTGAGCTTTCAAgagcagatcgaggaggagcgcA
ATGCCATCAAGGAGTTCGAGCGTCGACGAGTCCCGGCCACCGCCTTACTACAGCGTATTGCGCGCGGATTTCTTGGCCGGATGGagttccgtcgtcgtct
agTAGAGCATGAACGGTATCTACGAAAGATCAAACGAGCAGCTACAACGATTCAAACTCGGGTACGAGGCATGCAGGCCAGACGACGAACTCTCATCGAG
CGGTGTTTGCGCGTCATTCGCTTCATGGCTCCGCAGATACTTAGCTATGCTCTAGCTGCTCGACCGAACGAGCCGCCAGTGTTCTGGTACACTAACACAG
CAGAGCTCGGCATTTTCTACTGGAACTACAGGGAATACGTGCGTCGATCAGGGGGTAGACCGACTCTGATCAAGGTGGAGAACAACGTGCTAGAAATCAC
GAGACGCGTCTTACGTCGTGAATATGCTCTTGTTAGTCGTATTCAAGCACAATGGCGAGGTCTCACTACGCGGATTGTCTTCCGCGACTTCAAGCGGCAA
ACAGGATGGCTCAAGGGCATCCGACAGTCTCCTGCTGTTAAGATTCAGCGTTTGGTTCGTGGTGCAGcaagtcgtcgccgctgccgcgCGTTGCAAGTAA
CGACCAAGTATCCAACACAACTCGAAGCTTATCGTAAGGAAATGGCTGctcgcgagcagcaggagaatgCGCTTGTCTTCCGTCAGCGACTGATGTCCAA
GTACAAACAGCAATTTCAGATCAACCGAATGACTCGGGTGATCGTGCAGCAAGTCAAGACGCCAATGGCCAAAAAGTATGGGGCCGACGAggttgaggag
gaggacgaagaagccatGGGCCCAGAGGCGGACTGGCATGTCCAGCACTCGCTCAAAAGCGGCGGCAACAATAATTTCAATCTGCCCAAGCCCATGGTCA
AGCTGCATCGAAATCCGAACGCTCTTCGCTTCGCCGAGATCAAGCGCCAACTCGAAGGCAAAGACGGTAAAGTCCGAGGGCCGAAGCTCCACATCCTCAA
AGCGCAGATGTATGCTCCTTCCACTTCGTCTACAAGCGTTAGCTTatcttgaagtttgtattCGCCCGGCGGTGAATTACCGTGAAGTGCCAGTGTCGAA
GCATTTAATTAGCCTCGGTTTTTGTATGTACACCATTGCCACTCAATTTCACTTGCTTTCAGTATGCTATATCTTGCATTCACGCATTCACGCATTCAAT
CACCGACGTCATTGACCAACTCGCCAAGCAGACCCCAGCACCTTCCGAGCAACGACGCAAATGAGCATCTCGACGGGCGCCACAGAGTGCGCCGTAGTGG
CCTTCGGCTGCAACGACGACGGGCAGCTGGGAACGGGCGCCAAGCGCCGACCGACGCtggccatcgacgacgtgtcgGCCTCCAACTTCCCCATGCAACT
CGGTGGTCTGTTGGGGGAAGAAATCGTCGCAGTCTCCTGCGGCTCTCGCCACACGATGGCGCTCACAGCCAGCGGTGTTGTGTACTCGTGGGGATGGGGA
TCGGTACGTAGCGATTGCCACACTCTCGTGCCTGTAGGATGCCTGACTAATGTGTTTGTGTCATGCAGATGGGTCAATTGGGTCATGGTGACCTCAAGAG
CATCAATGCGCCCCAGAAAATCGCCTTCTTCGAAAAGGAGGGACTCATTGTGGACTACATATCGTGCGGAGGTTGTCACTCCGCTGCAGTGACGAACGAC
GGAACGCTGTACATGTGGGGAGAGTCGCACTGGGGCCAACTGGGTCTGCCGAAGGAGTTCGAAGCGGCACACGAGTCGCTGCCGGTTAGGTGCCCAATGC
CTGAGGGAAACGGCAACGAAAGTATTGTGAAGATCAGCTGCGGTGGCACGCACACGGCTGCTTTGACAAGCTTGGGGCGCGTTTACGTTTGGGGACGAGG
CGATAGCGGTCAATTGGGTATCGGATCGGCGTGGCTCAAGGACACGGAAGATGAGGGACTTCTAGGGGTTAGTCGTCCACATTTGCTGGATGGTTTCAAT
GGCGAAAAGGTCGTGCAGGTTGCTTGCGGTGCGTTTCACTCCGCTGCTGTGACCGAAGAAGGACATGTGTACATATGGGGAAAAGAGGACTATGGGATGC
TCGGTGTGGGTCAGACATCCGACCAGCAGACCCCGAAGCGGGTTGAGTTCTTTGACAAGATTCCTGCGCTGTACGTTGCTCGttgtctgttgctgcaagt
gcgGAGATATTTTGTTGCTGACATGTTAACCTTGTTCATTTAGTCGTGTGTCTTGCGGTGGGTGGCacacggtggtggtggccaagtCGGGAGACTGCTA
CGGTTTTGGGCGGGGCGAGTACGGTCGACTGGGCCTGGGCGACACCAAGAGTCGGACGCGACCTCACTTGGTACGATGATGGCAGTGTTATCCTGCATGG
GTGGCTCTGTTTGCTAACATCTGCCCTTCATAGGTTAAAGCGTTGCAGGGGAAGACGGTGATTCAAGCTGCGTGCGGCGGTTCCCACACACTGTTTGTCA
CGAGCGACGGTGTCGCCTACGTTGCAGGACGACCCGAGTAAGAGCAAACTGTCGTTACGGAGGTGATTTCATCGAGTTTATCGCTAACCTTATGCGTTGC
TTTCTGTATCGTTATTTCTACAGCCATGGACGACTGGGCTTGACGGACATGAAGGCATTGGCGGTGCCAATGTGCCTCGACCTGGGCCCGATCCCCGTAC
GCCAGATCTCCGCTGGCGGCGCGCATTCGGTGGCTTTGATGCATACTTCGCGCCCCATTTTCTCGCCAATGATCTCGCCAATTCCCACCAGCAAACCCGT
TCCCCACAGCGAGCTGTAA